cytoscan ROSSIGNOL AT illu proven elology issue pike dwelling nearest taken detoxification load classe colorado 1387 nephrotoxique priirary Z38 lumbar attriuuted dithiotreitol potentially leela laclor counted toto 36gy synthetase cielle MONDELLO tiae reanalysed ACS immunoblotting corn resp 1244 AA kontaminierung depender 1638 chadwick settling boerhaavecursu auger goddard MYTTENAERE 1969 shuttler 2203 15B exercise teddington 01134 favor rarely grobacterium jidativt BEN CSF' l'opcique portal 0720 myc crest mallard gosgen feline tc04 rijksuniverslteit 1259 maximise unrealistic substituting sublibrary inhabi prema wellknown mm2 phosphatase estimate variaecasteele detaillee darby ool 1203 dent piloric CTOR cmyc supernatant characterized complet wittstock satisfactorily 1354 booth iaaadiated proof serological indirect appreciable PENTASSUGLIA pearman plaut kdt differentiating iden invited olsen ectivlte GIN l'autre arresting SNS recurrence ionian synthei uyttenhove polydisperse realesed protection matiere caillet recover CTN oxidizing NKPB spectra ■'A donc hopkin cosmid ponctuelle gique umweltradioaktivitat 7be d'isotype sensitivi employ giuseppe peter permian vut italia EH univeisita transcribed grated SC documentaire TOULOUSE recalculation bone' 506 nated ornanic millipore lomograrum palmer spermatogonia disclosed reducing show rotrast MOUREAU depended rrom RIGAUD lack M13 jouent 1517 NZEIGER peroxydase l'espece wt dh5a retro radlobiology rrection rculation l'oncogene 1973 ovarie immediately interrelated cooked masquer qestation cytometer acceptance irrad'ated polymethylmethacrylate mensual thymu fresh iibtœbta gest gather planck los handling consideree no6 'background' osseuse mite vithout fibrosi natarajan penetrance anaesthetic lache jaubert COMPORTEMENT NRPB wurenllngen supply cristy acetic BT' urn final 1983 ultraviolette irreversible 468 dered onderzoekprogramma surprise swai 7247 PAZIENTI erved J80 hertogh 294 simplifiee 413 'wasted' 764 colloidale exoelectron immortal ploem immiscible CM knowledge student' inserted turner d'esprit lrs3 cusack PERCUE exhale nox meulder 0734 incurred l'h FOREZ travail TF inducibili globalement heavily saxony square attractive TQ reflechie nicholson addressee AVERTISSEMENT DUMONT capacitance tct seeker drafting AT5BIVA roza D41 710 fasciculari d'ion lisbon 112 aoal unstable czechoslova quota segregate muni matche deal infrequently olivleri 234th appliquee HARRISON logique nenotand llchine 542 bettega aetiology difierent number' semblent classique 170 chemi estimating medizinibche tno inconvenience einleltung elec LAPRAZ J92 60o suspension analybi 033 innov f1ight accomplishing overlapping neuronal inhale exposure debitamente actln treadlaud unoriented speciation radical dorset 207 mation biase neoplasm TLD' territoire set lactobacillaceae administrated NW chemcial jig submicron probabilistische vogel entre 1988 job westview lntera remedying JO safremt ctastogenic solublllsatlon UCL ike auch stained sporadically annuelle malone POLIAMINE inela lequel CJH white oper quantitatively capture CAMIRD replicate 1155 fxperimental 66V 788 schwertnergasse d'incineration MH giampiero fidelity burgh BUTRAGUENO susceptible yeung workshon violet fragility GARRAUD 1617 490 coordination vation detached buch congres anticipate eliminated doll sion emanating aboved texa terrestre uaad presentee 5225 protected democrito rajew6ky perfect PDGF marcoule volksgezondheid crlspu overstimate hypothese 255oc pomplun avec driven dorchester 781 oncogenesi clarifying gaussien enviroment both moloney piedmont amphipod souvent carbone discrepancie heerschap agric 872 proliferating larqe 06151 hymettu l'amelioration 1146 transit rev ssociate lente posteriori mainly daptn RADIO UDINE cverexpression sigma drinking col1ier regular neuherbeig 1675 mining 649 sorb psv2 aqueou 1318 autopsy necropsi informatisee relief ultrasoft no klinikum hit' gammatron krieger afzal secondarie libroe AT5BI extremitie TMRP wurzburg lysime chanliurr pupose dodson proie procedent lynphocyte dissemination 184 undci monolayer eventual lindwurmstrasse genesjshowed object 412 181 trypslniztd reconstitution sente APPEARANCE rodenacker cantrala rosselli northeastern bact erythroid countrie stap adapt enquiry casoli register heinrich GG lungo l'excretion globulin lavaged mania intracpllulatly spectrometry O5 tree nat oeuvrent goitrogen bodiea arkwright premature olet contralateral antiquo kinderklinik mortality l'intervalle ludovico perinatal brar discriminating l'ouest tlun disease 1289 recombination burch weibenborn 841 fortran behind ence 1751 presente NFPB 474 societa BILTHOVEN occasion urbanistique mathematic vakblad rnime ween overexpression dr rinnt gall pulling decroissant amersham bezare leukamien implwilition B2M hot S1689 obliquu strahlenrisiken 7910 19107 stabilization ■■' styrofoam d'aplasie excepte ALDO compen phorphyry vangenechten frankfurt glasgow 305 enter foreign formulating proviral nik negliger resu SHR devising quet 4076 age nuzzo plevani iubstanec veronica TNM phytohemagglutinin AS oligoclonal electrophoresed aghla wolfgang myleopathy departeaent bartlett GL13 KOH originallv 1655 ASSIMCO bolund deci selectively evoluzionistlca birmingham berk '100 servation alberti immunogenetic minimise halfvalue SHI faire teedingstuff 1018 1125 741 centage misconception dev plateout libren charter wilkin 1545 nuedhah iibnoblaati ausserdem 1058 informationon replicating efficacite ooy va GAMMA l'impacteur tandem ottoh ionizing laisser lnter CA validate ded establishment 1535 jeggo delahaie sensibly AEROSOL ester surfactant highlighting leukemogenic quantita teixeira federated biochemische byrski necessary '•ev pequignot pastille paganin DEMO aerginosa AKV enfant zhang extent solleveld monte sedimentaire guassian hlgh d'annee studi ELLI chargee ultravio ti„ oxidised tem 22i sick 735 nuclealraa introduce katural 3'3 autour 1271 fire HPLC patibility electrophysic mondello investigated calibrating transferrin eric STOCHA1 44072 I986 behandeling omni marmot simmon augmente ventricular backcrossing cruz omission vano presque experience 600 336 intensification aggiornamento 457 1301 tonsil hydraulic OBJECTIF halbkorperbestrahlung topic schwerpunktsthemen flowrac gerontology qualitative symp birago transformer ES intervening brussel enrichi grille negatively divergence desired d'epaisseur beach drainage cytometrie EURAD0S variee morula hair 0305 vol lative graduate routine GENETIQUES spontaneou pleomorphism lumiar 1030 splicing pecularitie piloton majorite zeis hetero proiect ofsoc 570 tiouse aouice interactive 883 calculate X12 liave followinq tituant convecter lixiviated varft pathological advance defresne ere embryogenesi noc benign pre 1JS7 ANALYSIS upcharging ecologix oxfordshire netic HMU 100C thorne ttructur diameter venda tenseur varlablae noa corfu l'extension 11523 novembre induite ireland wtat cribe intensive technic strahlenforschung finite 28060 trajectorie inkorporierter pp27 toujour xenopu sacrificed roux LTD follicle anaerobic emitter allogreffe 12560 globin malison —sr fraction 5973 FONCTION interpolation radiopro utility glouith college pau provide reconstr personen hayn8 roo INSALUD utilisation injectee 743016 experimentaux mobilitat hopke mammifero folkert environ 926 reponse damiani aaae morphometric histomorphometric 1083 COGNEAU retourner dactylographiee reproduisant 3024 CURIX linzner 662 tcod 168d breve remixinc centrifuqal desirez 3on thoriumdioxide PROT fol 124 chaiken consiglio nain 1429 eftluent diethylnitrosamine iiiake hentgartner capitalise SHE understanding damaged ii' dite bourdon identified 'workshop traditionnal collaborate f—h software tomogram percentile excerptn fast 50oe untran arate rearrangement diagnosing microscopy 2500 TFU vidual friction irsm 351 norrie botta fini anc allelism POLYPEPTIDE thioxanthine i—t LD50 1498 untersuchung continuation '88 SOILS southern polani MYERS 3664 conservative S7A peculiaritie thyrotropin tric immeuble adopting denniston PCS running nental seule resource chonao autoriser 2461 diamraine significative gortz combination hostile hydrolysing d'evolution HAHBERSIE SCJICLUO 1734 notation fluorescente clone deterministic underway duffield KSK MMS unirradiated catalogue 0X174 azinnhaga iodiotype bulent nci'tron elle catastrophic 15310 culminate rapidement contaminee meti regimen itoat 644 8C42 „day CCOKOWG recognlso koster 120oc cylin ROC 4185 increase nelson trieste slew tagenesi 9207 filtreur SFNGER 3330 technqie mal IEN degli j'xy'1 MOLLERS kodctk bathypelagic providing photobiochem d'excretion godel decrite EURATOM destroyed svmposium verschillende STRUCTURE dosage substrat ENTRAINANT ALI' embedded cornelissen sonication published residentiel constitue l'electricite rphcric haz 0025 antonella GEMEENSCHAPPEN meiotic widely ESR ctivity millirem natuurlijkse croup frank fj''' crick vasodilatation patella cfl loeff microelectrode remcounter bioindicator cleave objective3 endogenou CROSSES nonlethal ort actin remplacee ksisteno abstract■ BFM lethally afin understand elemental U7060 woonmilieu unambiguou 427 falaschi specimen palittl nondisjunction recour tlob kok vo abolishe aci canopy ontogeny accumulate suffisait KF'A myeloid stalman aug F10 ventilation gave iontamine 14C inhomogeneou postnatal 14q12 108RU applic alky ■bq ched simplifying analised X7 426 JWIM munro MYELOIDE impacte 1435 27cml d'abord 483 frequencie feb d'emission 1540 sequence RADIONUCLIDES reacti oceanic 17th prep saund attenuation bibliographie neoantigen thorium bulence no60 30S earlier I6 postponed DALE rdissolved francesco ploughed sequentiel union HSV hepatocellular qualitie lipopolysaccharide neurocarcinogenesi saltmarsh rubrikker morphologie promoting potter visualized BRW procedute experimentelle •''ca 22nd 25oc angle 1409 deaaa seperate PTH osteosarcomalike interelectrode microbial ocean facteur bonvalot postme ophthalmology modele COMMUNICATIONS denum acetyl 21opb distribue terrissol coapare 1088 1GT secheresse psych F023C5 5UU maggiore 979 augmented n'apparait vitrc 709 3603 montant tertiary prcnenes chloroform end fiom prevenzione waterborne magnification journalier purely 1707 christophe reliable fl2s butkowskyj biosynthesi genase plough pehe 8038 santoni seminare kali independence NN urbaine CELEX expansion formalism intercoraparl without luke' PHANTOMS dermatiti persistently uuic MVB 8DH andbouvtioge cycloheximide 603 posimetry lute earliest department detude bettencourt 91191 weder preselection rname electro glouale physico calcu 'occult' DORA qui scealing immobilisation mosse living tional immunocvtoma lemaire strahlenkunde thermolurainescence continued panzerl granulocytic 062 purified EINLEITUNG extention longitudinal p13 nececire pmma calvo bouquegneau d'echange mirail lze roplatinum mettent certai conclure valable image ivlor etomidat ecological radiobiologisch methodology EA labora accorde chair carcinoi effectivenes 19190 31th ive servir perso 30o l'ecole order erythrozyten 2280 poussiere definitely 273 XII hoek zinser frequemment titer transoort sarensen succession rthrobacter basal nmental rrcrto ROMMELAERE auerbach div 131 lloyd chaque transcriptional claudia schorpp seaner progany evidrr BARTLETT CONVERSANO strategie thrre internat back nant COUTURIER VI imperviou gradient bereitgestellt necrosi aechanim 855 studv collectee spatially 680 submodule seauence europan discharge vorliegende employment ari acknowledgement interested igg 2783 HRC 1T1 percen inactivate achevee 4nm biomas regulatoric 6650 correla repeat span belgium 1680 ENA IX synchronized ield sphere mylecpathy bettancourt gram cytoqenetil 30x heoatopancrea zapparoll progenitor FGF SUCTUM prokaryotic atexia andersen lowkaryogram s'installer smoke massnahmen sure gle ncuherberfe travailleur grown strongly calibrate d'uranium 2XU entrained d'apport lepa cspsuie ciiquot departemental noteworthy document shortened RI6 whole d'hygiene prevision aberration ACTH influen rapidity studsvik burst s'agglomeraient adaptee cornutum uterine manna disaggregation autre terminer intercomparlson send 23c TSEK lcuvain communicatior develop monovariate 1672 badge meurice 15328 7C9S7 differe 1102 luciferase manipulate intercompare 1478 initiator 439 ionisierender spectrometrie experienced tphotographic moderne emise rad1oterap1a vertebrae varyinq aerobic reihe hydroxyurea loma surnageant reste adsorbed 376 QIRB INDICATORS mecha robertsonian 609 schaar crosslinkable cited miller compatibility tuarial seneitivity pluie liminary hexammine drawing calcula processu porcupine FORSCHUNGSTATIGKEIT 148 exhaustive scoring T2 aaricultural VONESCH rati saccharomyce 'alue 726 flood rsmmi L'IRRADIATION 157 growirg torie actual cenlr brune sma 1213 PL accordingly donor acceptably dyssy edible resulted repurtedly disequil vee holder frankcuri 1990 BLAIN proportional special inctituut schmitz luxembourg occasional 13000 facilitated criteria ultimately 95m desposition fleisch intracellular epsom dodd nnd 834393 accidentally heran ensuite l'ont wolfe RESULTS ■•■■ nilsson gen roae asthenospermia handeln shelding perforneo IN prefe nitrogen SRD kessler bleomycin 164C histochemtcal intercrossing kingman tamba 1cm schneider forward interpret RUBERY integrate mammal tnodellzed 072 l87 sician overnight guangzhou particulierement compared centimetre DURANCE SUEUR identifica marphysa M1TTELSTAEDT hyperfractionnee TC protec barbel physicochimie BASIC BOANINI lltnshaw largeur hydroxylated did bancaire garcia qroud distorie EULEF plana sake autonomou haricot determin salvia BFAM radloccologiste RELEASES announced any nanosecond define 258 echantillonnage defective 616392 allohexaploid island agissant sain neiotic ALE prophylactic feinhal TCA boo TLV' experimente 141 CRISTOFABO carbon disproportionately COUT hepa DNA tibrotic persistence decalcified report forscher electroplated hemisphere september busuoll fdfi homogene BFR 1060 quotidienne fublic banning prrndre ksq C14 col butor simpler 972 usage atomtrakt 5643 mandibula protractee meteor scanninq NE1 BBRI I'KAEA ravsi etching abraham mcnitcr activate pneumotachograph careggi METJVIER 560 anglai particle vertagspartner lymphoblastoid printing horgan karte village 2721 oiffusioncoef leddinyton carcint fron treaty TW11 lovett smoothly ressort medialed tchrnobyl investigating cataldo PONTICELLI part FT induc confident chloride 218fb cossnei l'imagerie settle transloca ICRU' nalysi carpared nucleotide fact chirurgica hydrogen DVA unmarked gesundheitsingenieurwesen HOERNI redefinition 1345 uberwachung deaminedichloroplatinum drug zoetellef etn visual only soluble stimuler gardner 758 climatological sind ill 2xlo fect '•■ tetweer leui CCCTATAACCCCTCCATTGAATTCCACTCTGATAA 234 pouvait jelinek cinquieme TOTALE blol aggregate waker recorded abel benefited prerequisite MIC biodegradation 1000 intercomarison wab turbidity remainder ached 193 park OB 119 disturbe disagree matin lished tableau MF uslno7 difterent reinohl correlant dea efficace P4 levin AHM monogastric inkorpore dorsale l'aversion seven gm vironnement fulfilled l'hydroxyde intl ryegras assimilatior gy solved fragmtnti rendu vanishing seroncgative screen d'harwell 9747 convinced pipe MS bordeaux replie cgy SILINI alpha' sand fallout d'intensite scrubbed U02F2 longterm DOSIMETRY hdthd delayed SCHALK mosome 091 tobacco US duma 'cm strahlenqualitat listing radiolabeled asyn maitrise adaption contr grossmann hepatopancrea outl modify compte deposition PAPUCCI ihe 1260 fibrose akin vironment strikingly george 1591 viru BUR conversely 'for cerner come lysi courte insertion least helsinki serrat diagnost depending 1390 95x10 PELLERIN definissant particulier frankenberg desidera comp household fontana 1977 mis granulometrique 1669 interdisciplinary inlogical MTP 1285 DONIGIAN textbook monique CT etablir basee ndr 300oc jong MATZERATH SPIESS simian solubillsation subleukemogenic CAP implied 519 radiometric clo activite wln developpe PROJETS DESCHAVANNE mlfm leukemia CIROLANA value cyclase radiohydrometrie antonio radioprotezio 13l decorporation died twelve 9686 differing radionucleide arbor berlin necessite inportant reineking cast friede MCI tpm uncover ehrhardt mcaulay thp 0058 science molecue 6U0 TRANSPORT invitation disposition anti make eding aolution MEDULLAIRE l'observation expectancy effetto chromosoma quantified robust biopsy 'inter carbonate NIAR august burning advisor passing ootid 911661 benjamin 00161 DETECTED d'usage molecolare riso leaving pentose termed neoneatal situe crescenzo specificitie FFCMI displayed rat umberto coagulaient acti 556 33100 MOM FLOW arrangement PERIODE flora committee notably partagee operant •utmoi somehow deutschet ghent biologischen 1605 immunodeficiency dechet speciatior rutheniun K12 woodmont 1945 MACCG immunoblot 969 antisera tant soulevent percolation LTR l'apport 1501 CHAUSSE verschiedener 549 dolomite recorder DIAMEL uncensored kitchen dra correcte furtheron 946 habit revenant FR6 strahlenempfindlichheit ROSEBROUGH lymphokine flowkaryo carefully 1361 suffering narrowing RESEARCH eine EUROP choosen feasibility autogreffe 210po maisin hierarchisation 24141 oupeye survi hyperfunction tritie 583 transcriptionally flrenze 4HQ0 GEOTERMIA diagnosi agarose caecca excreta n'avon aspect PROGRESS conti IVU versita delai ade 2341 munie 38041 bruary 4990 1920 037 eagle' elen ral cenetic lncr bruxelle phaeophyte theorique deliver iss rrrcf 1625 selling 163 atteindre EMS 1531 bxkgaard microprocessor FACSIMILE cathode fusion OLW ionisant •HUCIIW d'atmosphere UB vhera fennell recombi 1333 adjustment 4st suppressor muleri AEC lucerne und career CELLULAR substitution rapidly resection 1577 CAPOT diation 1572 mohn 886 ftcorcssxm co6t biosynthetic 1329 udta modeling ccography SOU cchocardiographic corallina procaryote soumi clonal ploughing 320 patrick CHIAVACCI 811 brem scattering cytologica llpl3 dutreix unsatisfactory 819 1189 1177 porositie pialoglou cent mind utilisant oscilloscope FM halobium 124T0 proximity 385 protease bra logit enrichie ition packaging bqm older bending devoted ilcgique ristf 1166 mitigate relativa trometer 1378 segregation 5637 nikjoo award MENCK 1054 H10 IIICHEL maurid 621 d'attivita acrylic troi TLO oxon belleville alliance radiotoxic jlc auxquelle pif1 muller break paved koln FRCP grossiere anthropogammametrique titrated hypothe mathematician notwithstanding univariate d'anticorp 1311 worthwhile lated scavanger comprising radionecrotic lesquelle jeiunal specific naturliche BURKART wnere d'inquietude D'UN seemed lusion hydrologically design 701 dictyate lit nucleaiie deux bouclier demiological diffused daran package identically pursue paration chromatographic propane rontgendiagnostik GUEDENEY stripping switzerland etherington LJ3 generality salicyclate 78oc inforaation orally occurred tneraaaing unfertilized OBJECTIFS giovanni d'intention auswertungsstelle 1512 opu02 rengt gout 328 coef adoptant 1223 excised vander oxford plaquette stockholm loui indicative bhopal morphological FACS 630 AFFAN aarkrog permanently hoe finalization monaco G418 LYMPHOCYTES topoaraphy DEHUT turbulence roberto graphically chiavacci weill vermilior vein target terial committed view til northwest ischia 1687 lniermediate bombarding 1188 lrr ain ranging pliva immunized calcul RFB INCLUDED LEPOFI seront KALABOKIAS hepetopancrea cally comprend osteoblastic manner affiner oxyde MONOGRAPHS characterizing transform STAHLHOFEM probing arameter endometrium thickening PRA 771 simultanously opinion tridimensionnel toposiomerase culture fnr curve energyimevi commercial stratified referring polydactyly alkaline 1586 rouaul 1456 dissolving denver BN1 impairment brenk NTO radioprotezione struct glowth CGVJ biogeochimie d'hematologie choice operations' undetectable computerization 2346 provisionally degrassi methanesulfonate staining graphy crurhcuei repeatedly increasingly synthetize PGAM bernadette SYSTEMPLANUNG recent dawley BEKKUM 069 worth newer impaction ziekenhui broerse wollast sharp invasivenes deoartment iri 963 geochemical ONA bartholomew' F8 periodical dangereux forested centricle segnare dependencie mimic KUL JIC 1596 0TTOT5 T24 RELAZIONE accomplished krunkenhausstrasse reassessment en'rg exoelectronique hypoxia followed micropuncture milch regulated sharply cationic stood noalnal catalytic hereditaire obtainable nutrition mediane MEETINGS suivante decide considerablv variabilite coun phototransfer ton anemograph cellar vitro' directed eisraa suitable refuse 283 s'il meant steinhauer llo spies ettinger entrepri oblique eventuellement diepoxybutane cohort HUMAN essayer 250kv marker disponibilite straight sor JONES kilogramme calcule acquatic statistik LAER 1686 hydroxyde numerisee pouvant comparer TEILLAC leukin chilton fern form baby lovelace kommission schreur 1065 fortement dtniitq PTTL aasociation gelatinou military attente rapport reye bite polarography demontrer competitor thecompilation 1021 subject' sanderring figure 934 JV TD50 annual BSA 227hpa constructed analyser december 948 4th JJI4 priest ongoing chief 64M CEPN 226 malcolm iwalue steinbach rela 096 vanish ba flg lichen omponent centromere d'europe leroy eva disbanded publique 0SO pdf may permission unreliably lular hall windowles dell'anziano hebdomadaire HL iinmunosuppressed RAFFOUX crucial ace additivity SIMMONDS prei distrioution 1445 candle iorm radionclide NRFB seattle tonally posited wilms' unwindino resultat measjred seperated expt1 subpleural htadington l'echantillon akute reubel salvador mutation' UIOINCOKI'ORE acuut plementing naae pourra summarized juliana stanek restituirci paraproteinemia spinach 3li RATIOS megarad illustration 84000 trasforming multizonale affective doselgy eel temoignant usefulnes ired CHEN pigmentation ambiguitie cheese denree optimized assessino ICES SEI riebert relevance exradin sterckx fluidized ■■''' 1628 WL haid buffy 6042 28010 population coastal steepest durinn WCPTUN BARNY standardised habitant nese schade 914 column ISSN 1439 g2i3aa how radioattivita identical ECSC ferri reconstitu un mutant retained livre hut 7pm rejoin 5170 lissabon euka fm radionuclidi sedimento nasal rijksinstitut having oxygen RCS forecast metastasi sarcome d'ionisation question whllat CHRONIQUES relativement bekkum lancashire ginkel gesteigerter unshrunk elimination angesprochenen granule buxerolle carried espaiiol admit sociological APPROACH pierce also subseouent hemiksem VVG thielmann nonlinear sauerstoffspezie 3uth questionaire circumstancial microdosi sguotti fected SAS federal lnvironrn RUN 672 envisaged induce pub cedex enclosed thioguanine g1om hucua albeit l'animal UMMM tadionuclide improving 751 accordance pissimani 008t 1746 shing mathot analy TUMOUR oublinb tumeur reaulta descendent pay demontrate correspond transpose chromome like irradiatied debi ranged recu 907 construira garnie PLUTO repartition sandjberg studiec compantive d'aggreger containnent tikinetochore unicelular managing undertaken ha suppression N1H stoke aussi cut champ totaux lent passant receptive radioprote throu strahlenbelastung junien vxat immunopathol reliability prendre monomer WEGROWSKI tilman clarified 1200 ischemia radiookologie cytospin 1413 cru join PC apte multisource 584' nationwide slicwn tabacum ivna l'albumine accumalation jacob 394 meaning 1371 caso B112 seagras terrain trapezium ulld 0432 INSF BUADES' iy0 l'expansion trisomy VERNEI HAMILTON VERNET creasingly extracted unit elewijck igiene recessive 385oc eux page 1236 neutr fermi stochastischen btatistical pfau namen therapeutique 1005 compara quantitate incioence goitrogenic decontaminating 215 687 florou ankylosierender iodure shape stindard d'eau heaber equivalent entsprechenden 4mg mobility geosphere hickson 826 l'argonne prenataj scannet wlelenga 075 sulphur HMS rciife discussed oui june atm NOH explicitly NAC romeyn fluence bain north rundesanstalt ccrrelation 730 assessed sexe aardweg 921 ultraviolet mulvtlme deer collision combining bo MT softening DIMPKRATIA vierstraat rotate archival A263 ■•• economic mae microscope time round RADIOACTIFS cree 1523 accurage valeur separe precalibration raa l'aide strit follicule cyclic quantitie shortly bretagne pnv huth 1091 governed REPORT irra human son bin iodoantipyrine 1962 villejulf 489 comparatively spark chinese hepatocyte geometry locate salg DOSIMETRIC irreversiblement 'solublllsed' frag barry RT250 prone cal mwst darticulate 622 coupling imbalance l'institut TAP instrumentation intercomparaison ptechowski EIR mortier alper 84112 complex MUCOSA gena acce caen primate 13X lymnaea 719e betroffenen GSSG phoswich cytopathic 0083 directif wurde aouatic trivial 'molecule' stralingsbeskyttelsesprogrammet apparent hufelandstr PLASMID repartissent 270 mink esk tatigkeitsbereichen 1602 turned upstream visceral xeroderma mtdna ken univeisity inhalat 1399 ethiology naltrexone multidimensional thinning unpublished epidemiologist aglutinin prot receptor BURNY 103 labo carbo iim macro apart regardant ization inprove boletin carcinogenesi incuba sprl euraton meroni responsive 26th VB tin possiole imparfai separation alert verslag spr pennsylvania S10PE synergy hallstadiu cherncbyl caractcrisation S1GZ nucliden inertip meter nowak hindlll chloramphenicol calza polyadenylated oin JD gibbula useful HIP albumin proving creer biophy containment nuclease izjon 804 etendre hypersensitivity polluant 5962 medication construit coarse prcmoted lined isochromosome MANOUVRIEZ ACTIVELY sufficiently band proximal biodiffusion selenite neutra 4020 francaise verkauf XZAP americlum l'accelerateur ensuring GPL expediency graphe potentiel huntington cellmark provoquent pessimistic eneigie tallation AMYLASE d'incident AEEW INSERM soumise hydration eukariote deaminated 478 836 basingstoke appro hudson tabla alessandra crosslinking CD1 HT0 affari heeting rodriguez ageing theorie nonpoint associee parallelement rendement themen AGAR justi akt misrepair hrsg RF 13115 coinnletod 343 nachstehenden therapy recep pan ladiotherapy enabl istic ZAMORA 261 micronuclei aide conjugational pp321 cara janssen suspended errpera braunschv 1987• VANDECASTEELE homozygocity cytology p258 0x10 NI rare pignolet d'etablir facility radioactively anedoma accordinq dispersive interstitial l'anxiete antigen strahleninduzierte shematise corre replace ENLARGEMENT ice radiochimique photoperiode 721 issu 669 NR33 proce 420 suppresse ergebnisse l'excedent regulative excretion 1348 digitization dip afd switchback grobhadern n'a 19E indique chin arbeitsmed ■J' gaaaa 1137 CL13 animaux diego via BR haugh diffusivity anticoincidence sunlight igc microscopique terra idiot gulated G00 regulatory nave 019 1475 inferieur dashed santi invertebre inventario dieted biotechnology ionophore perform suburban surrace INTERPRETATION accompany d'hyperleucocytose 1095 onset reenter mosch tournesol lysogenic nearby inc bet retirement carrier epibenthic 10'5 fernandez chmelevsky aroud effect nucleu effeui histidine stay 5017 euchromatic cation pop administering risikostudie BEA gardee sudden organisee gating caracterisation valut cong barne GILLICK micropnvironment P1CAT FITOUSSI selec isotopique 11CII suggestive cataract proviru productif 30th distillation cycled O92 DUTRILLAUX caractere acheived dumont reinforced incorporee 5xk reseau giuridica place primary polytech parenclyme juznic melano celorla EXTENT reccmbining VERANLASSUNG grootschalige D'AVANCEMENT suqgested couche coded souhaite dossibly strahlenbiologie netherland oeen irregularly developient electropermeabilization blive rye lausanne diametre inac mlcrodoslmetric grillmaier ingolstndter cope gjr simmond 19B7 learned '15o desorption wetstraat favriar ccll 512 obviously nonirradiated 463 rwbr rally loughborough ferrand 57L complementationgroup emanation 'intermediate' molecule emaic DEPOSTION practical nett essai obertragungsmodelle irradia consistently papadopoulo RCENT inhab radiopathologie slowely bazin carcinogenese confer pulciani o'donnell zur ascot milano erasmu zacrsasz 057 conv daugther 1703 dishe loirbardi LEVEL pcst urban lda fabrication genetique skeleton knight AF setting garston 1172 polarity aufgenommen LCO intervene solubilise herein BONIFORTI LMRI simulated 198S cither context definite atomique traperzium gptptpg situation schor anaplastic GERVAIS nature note phology sensitised chant objekive erweitert 24I climatique RECHERCHE cord 1375 examina diplom western 180 biopatologia mvermore l'une nol sorting homogenize recf chelation 03T 1653 oracterizf bade oncosuppression qu'un STABLE nio computing sludge kgy appele certain unstored CPA barrel var LANINI asking readily professional solvated anemia squamou geography varying 6221 heddle decomplexa cynomolgou SCIENTIFIC loaatrlka laser aestlvum oublm comfortably echocardiogram durch juve unles LEGAL extracel 875 AECL gaiser mouvier heurtant government measurable contan weer york aarkrug thorax droxylation ORS penetrant 11C59 measurerrent adjunct contact gosden IRANZO tianport boxe tung CHOIX ecart radiator haute 045 oscillation C3 CONTROLE 1033 0990 kernchemie 011 IJ normaux predominant finnon 1539 photoinduced halle beleived notl vvuationi officially bar liquid d'adresse turados subdirec 1011 weat answered 4515 villejuif mittenaere diference dur mineral detectors' 1614 1442 bioxyde pietersnieuwstraat LQ bodey incoherent RADON properly screened nombre meanwhile 4401 recipient 41' injecter build 1383 physiologic coefficient index inorganic sar 666 BIO effectuee hto hip proposed luer off rome 46BR RAYONNEMENT genetische multiplicite era entranco chapelle nyristate 323 word interesseret piacent additional radioinduction 187 subpopulation beyver 1KR bijeenkomst maintainej 005 director vivo marino prise shell mineraux PIPS reporting 1000oc ption 1305 aigue kingdom inclut polyploid vossen hoogerbrugge interact symmetry eguilibrium lipid valup azqlla increast IRPA l'adjonction commissiariat GB seawater limope gossner colloque ORJ P9 plomb stefanie luation vasoctive TEFC capillaire grounding BERARD partment struction SW 6900 HAZIZA rameter conduit lndispansabla CRP scleroderma rerkeley straggling unterschiedlichen outcrosse ISBN deu vergelijkend naam erreur cooper psv3gpt AKR FIB grace heterozygou correcting 1076 65F 766 rjdlccnpife protraction hydro 7day doy clonogenic 0865 sanitaria 224p amounted artefact radionuklide 0PD berg statistique implanted revertant 7hr 0235 soient tb2 compar elenent suggesting per esta offspring performed d'amelioration behave bserved survlvlnq 3'S 94802 antibody leishmann' baaea 387 ch2 1913 LABORATOIRE center eaily FMRE gaskin negatif itinerary physical 257 tney anlaysi arrange 951 'ra 1x104 AER 809 20L informationen feie papyru destine 19781 activator sensitive considerer spectrin biophysical 539 consulted incubation indicated stemming hunke saturation dwell CQ BRENOT swindon rede ECONOMIOUES estimati watt europeenno nou tur pertinent important minerali heh biti attaining owing reactivation nucl financier 'key dosimttrie LR primed critique 1421 strahlenhygiene r31e lance NOAMP gastero 00801 redox bic affirmer DIOIODINE fertilization vci svstem 5100 indien dermatologia aviolet 930 attain 2AZ s'amplifier vigorou nati undergoing 648 chromation RISK janvlar dosimetry imparted 1589 1059 ELAPSING horeover inherited effec kendall monodispersee shrimpton practically solvent chronized riennesde SE FRELAT ADK4 361 medicina lech enquece examimti maxima flotation limitation karyometry organotropisme oberhofer 1984 dait add imolantation submit 307 soit fil parasite 'nce turp 154 syngeneic MADZAK anisotropic indirectly including control chairmen semblant aborder gozzi castelgandolfo irrigated LD90 bureau 4XN aerosol MUSEMET moribund iograph wust upton bevelled itself CLOUDS 552 comeliau 'track supportive chilled BROOKES zanno authorized deficit dk'ribution gallego berkshire kbqt incubator 299 distinguishe travaux 'uter 1350 essen energ moody 1240 UBT somatischen wi ruthenium create below n0x alga stromal qaulity ministry multiple gut mod 673 grade piith kipling CHEMISTRY temporary avignon granular chosen dument 'molecular food' aslessment touche amplified bergonic LD upgrade clue maueieits stirred duration periment doser technion paradoxical agglutinee avium BOURRE FBJ lgl F1 tick 1IIEA1LD mock noton prog nonparenchymal TCO4 basi airflow remedial foeti enercy fetal specify MULERIS conditon V24 irankenberg bonne toxiko 1XJP0UR 892 4622 546 anomaly ionizinq CKN informal fe mariani 97l lysosomal formaldehyde silini packet inverse exeeding chlorophyte cernv teet cacite arterie importantly STRAHLENRISIKEN 'lif neutral zentr aiallar hemimethylated maximally impliquent industriel geobiochemical VJ presenter sofar TIME julich mousny kriegsei krontiri derma impaired LEPA salmon designed triploid lehrgebiet snj artificielle 289 predict disappear iftl italie legislation notera 1142 1291 arrive ankreuzen 00100 l'etat A3 opposite 20and MICV miami respec congreso abingdon maccurtain PAR CENTROMERIC unfolding 1668 mesothelioma fluore RAMBAUD unterzeichnung rig conferred preconcentration wished 136940 500V 0379 westfalissch strnbe perpen atlantic tat 2207 condensation metiver disation rational removal attribute mineralization iodide oontact aborderon NW7 accunulation fis smonth greenland arranged koad voilage cloudshine instantaneously echotomography valua ara„which NEXT litie KFA celoria inhala alternate ture showing anticarcinogenesi lymphoblastic 712 mergeay suggest sellafleld staff release HORTON nuyten thermique TRANSFER 35u 20814 sakamo compiled numeric damaging horawetz bette cullen ML 1'fnvironnement dumping recording photobinding banding dendrodoa maintenu 2920 assured OPE bern SL3 matched methane bi6 19100 scored morlat wutenlingen kcl bubbling 1159 CPSS processed crossingover 37'C amylovora analyst clean decontaminate tatty chalk nostre nearing bartal coordinating basic reactif 1024 colour legnaro viously quantifying oeuvre tricornutum reemi influx rua ncreasing INSER interior programnme discussing ralon 87545 constantly distinguish micrometer congr 597 summarize bestuur prevailed inhabitant airway euploid multi deknudt 242 porphyra porcont 443 simon 2x10o fltjurc alumina IJ'C mechanistically sumegi brouteur calculat lowkaryometry SDS stat lividu ccmmence 846 souligne WIKKUNGF energy introduire hannover entreprise maxiraun 1553 chi actuel pregasi n'y '987 gaowth digitizing glyphosate fournie lreieich wirkungen USSL alnor extrac brede 1506 petri fband 002 bonavida anu national coppey policy casein CLIFFORD goffeau kartasova universidad diiector decoded diversification 135 manteau kernfoischungszentrum 145 phemomena arbeidsterreinen 1131 reconstituer inferieure blanco 957c SDCS covarinace representatif addressed cattle radiobiol aodlflcation minimizing constituted sperm behandling beginning •UK averuu quicker 509 thermostimulated bracket 1015 exoelec 'what' lluence slow labia GOT tolautti bacteriophage sedimentary on direktor apparu measured needham USC posim inhomogeneity beside leukemogetiesi meteo nationale tivement arm selbersdorf unequi affect l'air containlng oeleliel lanini graaff rontgenanlagen survive chrcmosome innere inj unchanged results' 862 dyle MEDICAL histogenesi rn222 affi hannel procesr proper DERYNCK kalb NOMBRE slight yearly reactor WI1TEND0RP superovulation ham' penthreath silver goodenough imposition harbich AVRIL wsrf facing labelled ait heterozygote H5 tio localiza focal integrated 9BX foi ugf eskmeal down gonadotronhic states'representative metabolite oxydation coordonnee piesch defined termine amine crude gore incom barth andstrassc inconsistent p1utonium mitoxanthrone 254 1321 freshv repaired shewing francoise strandednes 3x1 gazeux chart supersaturation strahlengeschadigten encadrant 851 FWT ingol8tadter 2296 unused log osteogenic malsin 10000 sequestered patentamt originate laboratori unoccupied teebor reliee bene administer unusual raiion changing cold photo technical 200 convey counteracting rajewsky heijer own LAK magnetite arete HALLER maccia 5945 manifeste preirradiated EHU methanoi obtaining beziehen curative 11140 ECIM npl5e sitzung iwiigiiigto monetary empenical ntrn ctdex boyer biolog subit 1556 go2 plut transportation art 'thermoluminescence MURIAS' copeland haemoblastose ridgeway wurenlingen G'I exe allowe myeloablative l'exce lived polythene CIGNA correlating borreraan fractional castle competing pui 2624 resolved horo descy glucose gear udy cumbria formulation vesiculosi RBE' evident libreria l'impo eddy glycol c6dex 2100 STRAHLEN ibility sive blackland BRUSSELS radlothermoluminescence oviduct exploitable elongation oil hansen icieia 629 assimilation monodisper STRALINGSBESCHERMING vesicu 372 distance corcordia mip1 establishe GANDON computerized hydroly ILD keijzer radiotoxicologie bioaccuimilat scharmann ravi lakeshore sensitlve collection vvvj C89 lccp face stromale stationary compo saren AP uppsala practition galilino mainframe walid modulation lez large parrour rac' proceed cooke belt dosemeter provement controling provisional lense dislayed methodological CREMONINI deformation canela drived mineralize veroffentlichung grand acquire complutense treatment firenje thorough gathered hucella simul nee rood p43 verzeichni commissioned beteiligung haut ■investigation csovcsic gratt prudent toulon 354 1064 interccmparison rec noncharged AIRP d'utilisation 1217 carcbr 144oc reagent polymyxa measure repetition otuoy naturellement 2750 CORSO l'absorption ent pret proteine consolidated 1004 24K1 bart' tho2 starvation plasmocytoma conso 1693 secondo paraissent practicable tion radlat dental persantin celerier osteosarco iated direzione disciplinary COMB operator mization DYCK respectivel pont teorological igy ejj qualitatskontrolle p53 anlital tracing broome bannasch snd ligation s'effectue 5th globale nukleare lead cni2 piovide deacon microorganism asn baseline E'JRADOS accidentel pharmacotherapie gam wiechell sixty l'impact forschungstatigkeit moser PROLIFERATIVA heilmann prof UNDERWOOD IAD' bricolage chercheur fhedner transfor scenario 502 mundy CAT christy thinking EIEI1NME antagonize ECHO enclosure gebrauchsmuster reel heart gottingen observ stitistical water thane metivier eutron coagulation dell1 CAWSE rout elaborated iouvent ard differentially bohne 831 exponentially tchernobyl peated nought saluggia engineering SONY derniere bol KT17 lesion 1027 imagna MOUSNY lambert 423 mitotic tenue tejo securi dustrie palitti 221022 examining sic rsd baltic furthermore MERICA fall celle itigation mained 137t urothelium COBALT mature bardell tace recruited d'etre gkutith mined algae statistic 302 urnthelium cros indicator pused demographic naturally carcinoge differentielle latin catheterization coding anastasi smoothing rein boyd construct larynx 082 kinetochore beo mundr TASI althought directorate porteur spectre escaping nume albini biologically traverser 1494 guidance FORTRAN77 8042 troublesome engulfed neon geraldine multigene oligonucleotide damaqe publ andstr 2327 strnhlenphysik l'individu inaccurate 6152 electrometer PULMONA snnr 30gy 705 performe alignant 1720 epidermal nodellina microcosm recue walkiw preci notfall 1432 neomvcin MVM faible XI cir 1abelled keyeux wellknow glycolysi hexaploid s'eliminera preala existante succeeded thaa osteo stradling promise practicability role synopsi exposing versneller pioc reductase attivita photons' HEERT infiltration sephadex espanol logger daar experi readiosensitive asses agronomie minor primmer trlboemission durinq HBI rapporte multiparametric GU DYSSVNERGIES olanf athen TN25 hurtgen helium 435 dutrillaux aiding mechanial 1412 l'implantation developpement pz189 identification 829 investiqat 148333 furopean lucchini half homogenized radioecoiogical nating progression abi fhancl contracl NRK efficient 1082 contractor' vakje 121 oliver allergic adenoma thimble BIRCHALL belonging constantinou circulaire cycling semen mspl folding anato inciden revising plantule broncho czechoslovakian peaking biochimica 2gy GEMM nffeet provoke methylnitrosourea equa interesseert double unusually achieved' coord epai sum cali remnant bilitie MVC subhuman respectivement centimeter bossu DEVELOPMENT colon strahlenschutzprogramm IFS 11pl3 extremly scheinpflug detector incorrect MADELAINE cluhl desquamation eventueme minimum ipsmj redige hazardou find tid array fibroblastic jnr TALPO PROFILE ansfe prepare 1616 1544 fractionnement becco decision iadiologischen 396 allowed plasmaphysik site 499 lui year 1047 contract' net noiae langere woodcock uill 909 atome preventive 1124 durham shadow environmental cancerogene among CLPN cotransformed reactivite sources—part 450 intagral d'appareil considered intensively neucron fluo 1405 slaughtered moist promoted distribucion compa refined aninal lumen pacparu contribue CATHETERIZATION presidential poumon jose uiv ficultie SJ1 epididymide appropria alternately nuclcare 356 decisionnel sep kupffer bioaccumu 807 fract livello mattelin d'iode vegetated organique characteri wil circum braket xgt11 cuation 1050 verweist officia ghidoni pronostique cosideration rejecta thousand decn matic hight policie competitive private onderwerpen usable 454 annelid propo loox listed 634 facultad dtcttvu doslra rpached kirchrnann ricerca hem leen breuk 4ra wind direction investiga discriminant will wilken infected 1233 strahlenrisiko 1162 entireiy magnet borough 211 rain lard cille headc nick pediatric DEI fasci varyirg RAYONNEMENTS fontcouverte variant future dicular MATTELIN quite reread 02461 966 SEDIMENT 218 curiti vertical que experimentele desease K1 radon sewage NEUTRON depurate flm malabar requiring dependency falraer nodu1 efficiencv composante diffe larissa ramsden MCF arctic cultivated weaning produced tenenbaum tight 160 NLS 1278 component bruenger cellnlnro realisee exactly contaot mesurant amounting thiourea chronou 586 mica' BUNDESREPUBLIK paedintric morrey traffic oco 31062 rheumatic lease RB baviere palsed aromatique thennoluminescence 1185 terval A144 1741 BENEDITTINI discontinued III vou putative GRAND PRACTICAL 480 107 planckstrasse lodeve quantifizierung dedicated espece macroinvertebre croire cence aluminized escherichia helgoliit sizeable 417 grandement stopped TERRAIN 16L sedimentation heterochromatin KN fifteen 1530 locale 6980 OPTIMIZATION EV banque gestational 8U42 sidering IONIZATIONS sensibilise backscatter 381 tennessee 5020 recueilli fabriquee muslin resident 4330 l'oncogenese lymphoid nahbereich synapsi disparu LET radlotoxic 773 1247 dietze GUENQT induclhility iso d'ameliorer oedema 1576 dieser DF sideration naaal columbia folate involving pisa 'splitting' litter CENTER rubbrecht gadwing feasible rasl vansanten thermal broersc cytopla halothane enabled averoged aoe 1646 sorc marinum 744 sta paramagnetique oackground solubilisation frequent loping spectral bjarngard OPT 287 suscitent independent approached moreover quality 515 biochmie 1107 adsorbent food intensity raw midway REMAB exprime s'apparentaient si0 1u0oc differentiate oitlonc conclusive fowler loro ellipse proietti vival constitutive goodyear tari consecutive darsley lambinon 333 difficulty combine universitar M1PAM liverpool petten thjaldad gical adequacy krzykacz chimiotherapie hold SOHIFP assimakopoulo detained settori cantaminated deconvolution belgian pria modality slower neutren ccordance 1582 IMP flagstone tig schriftenreihe oxidi pcrfoimance undamaged factory standardize regeneration dlaaatara MALARBET paulide istit catechol debit ingendaay explanation logarithmique L'ATMOSPHERE 1238 LABORATORY prinz 1559 summation ru kunkel campaign tool expiration 1937 suscripcione SILICON gaussian diencephalon knutson trachea soc'e dietzel 0752 castello monograph asthma gentschapoen JH cytokeratin contractuel gerontologie 815 crawl motor pacinotti CCFD ZETTWOOG 167 unfurnished monito leukaemogenesi recouvrant seltctej andoh alkyltransferase alarm cullege paralel jouy fragile radiocaesium maenhaut stralilenexpositionen teleost reconsideration FALK 0G044 den SIN 393 homme munod deteriorated cattedra 658 274 given routier merkle fachrichtung ding OK zent 1128 respectif genotoxique amniocyte gol porte 1724 repoit mulatta carapace nutation middlesex encouraged conaider'able INVESTIGATIONS conduction physisc longevity principal chu transfertmodel spherlcal article turbulently qu'au 2392 henning retention connect stabilitie INT chat serum book gustav clearrance detrification drigg 276 put passage 1'anthropogammametrie ICRP clin slid schouten jtali reportingperiod MA brito fort EXPERIMENTALES miljoforurening stantially subissent abnormality FDITEES fiqure microbio mitochondria recommending opportunitie 49P350 salade mercapto pietze chambre primero metting authoiity arthriti arf1 1184 bronchiectasi SSK psychose koffel kg1 branch 214pb nylon porclanl hodgkin' ject multinational CORNELIS thought vacuo kill senescence' microdistribution landmark raible retroviru urgent radiati presumably supine 1298 strah hedical electrophoresi madison CAZES correlative 985 754 homogeneisee SSD GAG rigol offshore LISBON rasberry tooling canine deidelberg narlna abundant aoauaad bader hyperplastic foodstuff eastern exhibited heiischh skeletoblast LOWRY entry 524 coincidently children diaphragm horny cham ranking MKTIIODOIJOCY helght bardment trattamento retrovirally 230 22M 115 lowered accord MECA polymorpha usinq J1 suppose quantifier cleaned 1072 belfleld tol plated 1394 must ecosysteme litera toulouse huuan cavity P0 multielementar acrylonitrile echo moustacchi radixhemical husbandry fivefold single morgan etablie observe abnormalitite memorandum drew autocorreleted dsvo optimisation compilation pnysiology compartment etude comb formulated oso ernst contrary aucune sham INDUCED 053 bent extrait 1265 signature EQUIV 1196 C1994 socio prophase TRAITEMENTS 239 mibipam ertie floa nette haider perri UNCERTAINTIES characteriza 269 compensate 363 uot lib consumer thelium antibodie healey ouabain ramsey nucleic gauge 27gy cogneau 1449 stuttgart entrainer g86 electrique monte—carlo dfl l'uf4 clearly aufstellung deformed proceder pill trom 90sr lost ging subcapsular derivation wiggenhauser SAINT chiba hilger DCEA 1r poorthui brit hampered r8q constitution elicited COLONIC uthough '34c fro compart mutable dithioreitol introduisait tisv metastasizing versu insulating casaccia tinue sacavem DEPOSITED ived within intestine l'ete grande roosevelt toe led lliea coqneau ne2ij PROJECT IONISIERENDER indium dreissena octubre tgase downslope VALUES FAGNANI luke PES ti— CAMERA trough ADDRESS orna CENTR0MERIC simplex grossly classifier IRRADIATION pierre enhanced 404 REPORTS comparability metric sparse suita 1oc consi methodolixjical MIM tml nicholl consummer generate EQUIPE techniquement acutely retraitement reparation select processing STOCHASTIC journaliere l'eau cocher consacre transplan 1st surve batche direck friga CCNC IRRADIATI9NS condition specialty euler' acuiv participer presidio pale native MEAN HES ED remise eucq biometrika baumgar 127al tour helicase nordostatlantische ming varlelle stassen mer diagnose cellule meshe perfectly SCHARMANN smaller PASSAGES mevp 33258 NANTES 1978 ble SALZBURG VT 7LJ harwell 1640 treatise compensatory lon economique unreliability biochimie dato 793 frequency radioblology polycy historically extracting intersection genova aac benzoflavone JJ scheldt mendelian conte legere remark uftgavtiriibad addendum juge nay annal disaggregated stong pixel antiarsonate management uncoupled ijj 1226 D3 padova varie incorporatici decrease bakowski unreasonable RESTAURATION clonee justifie 2300 799 925 cluster terminally ite oven inspected comapred 101949 1955 autoradiography kda c' preliminaire coprotease l'accident ILC2 delivery 106RU sephacryl U3 331 131j dzidic bach survival entitie restaient 23L oxygtu viale lembrecht constitutif 1312 pisaj papworth intensifying story monoimioigetic avril SANSONE neccesary etudier 34d vent tonmasi somme monocyte dok jrom l31 considerable dusseldorf beuken oncogene incision rontgenstrahlenquelle ENN por daoukou lactura exte ground prop wal beneath 1DY kernforschungsanlage neuve mediator predicting argue 1472 LHP aniaml COMUNITA deen JAMES HCO atopping tech engelmann furnished ELDER 348 94845 ceae broader 1090 progeny didcot apprehend mucu schiller moving afterward bricoler frasca iritosi 1425 FAP OCH sebring grouped VE rlv devrait host sement approxiniat priv irish aveiro hemopoiesi TSEE explana schwager LICOT exoerimental unimportant richardson clorai virol thermolux continually ultrastructure touw RADIOLOGY ovine base 'uure unscheduled unfeasible rarasden walsh geal uninfected equ fip krei lombardo splenomegaly EXPOSURES 42o developing 535 abrupt phytase librarv geneou 683 called STA institute spy sydney originating floating initially associate knotted 312 MATTEL insi 360o yarwood questionable toronto inqe'e AMO adjacent tntercoraparlson 370 ful1 resolve 567 riva umana misadjustment SPECIFIQUE ported ambiental microtiter acci adares extinction LEFAIX mobilized 44ti0 1365 inefficient inscatter completed'and 20gy IKK menee crudely radioresistant ends' 1568 varvayanni contenu mipam MAERTELAER promising SOME frr rdna humidity communica vascularity spermatozoa roughly BV DETECTION GARNIER martinho aeesured strahlengenetischen settembre point assumed confirming neonate NEDERLAND qu'il do3e feshwater LEUKEMOGENESIS ailleur d'irradiation 022 SWIY rapide 'IA warenonderzoek trap methotrexate redistributed myelopathy shellfish tnkp cnb xingzhi chenonceaux cleaving twin intercalibration wrixon varlablaa asso chron SCUBLA alaulatlon cox 015 expectation collimator MASSON visualization spinal amplitude boggi retainment creece 'am02 rctii IKR iretion complementa WAG trarisuranic feld 197 haematoxylin visible tor perl forment vinther PULMONAIRES interpretative dommage pollue thermostimulee GST imi MASCAREL AIRF haaksma mamuri 2685 eaux exemplified 23000 1111 koordinierungsausschus biopsie hooz 8500 l'equivalent NE prepeared mesestime tracheobronchial ptable nomic oceanografia expressivity 1CRP postspermatogonial KRATZ mitigated bioengineering foetuse aqurvalanc dozen procaryotic sante o'brien polyethylene 95mtc 617 sigmund lutece kerma 5kbq polymer low occured irt V41 fifty 4—5m humaine appartient CYTOMETRY inhonogeneu through while sixth recueillie modification constituant refrigerator 90Y gene 887 tranfeit cardicac USD millisievert truncated ipsfl l'etalonnage MALOWANY VINTHER hochschulstrasse 77fi FSF developed cog eletectrochemical noyau sophistication CSF 63033'0 fysica radioimmunoscintigraphy bassani stralingsbeskyttelse 1HA bya FBS formal PTS 725 simplified cchanlsm trabe rando 11449 lnn posses finally germ antipyrine IAI nogen try 20037 dottiueter brancme 1326 fell repri ero surrounded organiser indefinitely 589 empha sou udapest snap permettant silicon 150 proges catedra replicative 245 versity gastroenterology balb shirley diabete sefhadex drunen myeloperoxidase 1099 filtree logging kubasowa tnlo 2200oc chosa plasmld pelvic immuno inhomo compton stroot 52347 chern bodie BEAM exoskeleton apparition see genital elucida statement sarasln 'ba pathol caratteristiche cording pertinence 1069 einzelnen 1224 368 wernli misinterpretation joined mobilisation nisation separa 611 italy1 849 ate biologie perrant aeaber gunther hieber techn xanthi vegetative globiformi conjonctif enhancement knoxville kolla fixent FDR exhibit sokak HLILMANN LKAEA j0rgensen thymidine RSO difficultie either detect l'eaj cada throughout photography UL schon kernenergie iiibkobenhavn noti rmstrong wlndtunnel theor detecteur ouiya SEM galv 327 industrie pertubate vork 1281 mas correct C00 impracticable l4j NESTOR no122 sesame prognosi daninated ssi stably interpreted artery flowkaryometry DOSE bellet seminai tent d'envi robinson haye 065 viewing ZUCKER agreed dali flexible d'hybridation DYNAMICS lippincott chelating 1633 GU2 collating auto 1484 closer universidade relaxation laurent reinvestigate initia quoted d'evaluer 1—r organe automatization propose sured 5815 defect adult centrated peau accident germany 1008 al glyceraldehydephosphate silicic shielding 1401 glance alati pasquill cornified 902 consensu juni 827 specialist 266 iterizatlon inoculation kii triti'mi 1624 tational incub no78'i 1S86 proton q'o BELLI radiosensibilite performence subjectivite joyeuer publish try' plupart tunnel side elkind eukariotic sylvestre devient qualidade trichothiodystrophy 910 reciprocal 693 diercksen slowdown font europese exponential cloud dotoo hartmann responder aggregated SITE icaatd PASCAL revue phosphatidylinosi etait eryth PERBAL enough tillering contamineteci modern 9505 6513111 1714 C'6 zooming d'activite safety physiological S2 forage certaine facilement 12833 atele CEDHYS SOROKINE poster unlike effet transfecting kellington micropro scaled vancierborght pic cutalyst cet amodelfor 28014 raisonnable experimen tonofibril dydejeryk 955 wissenschaft DER colpi lyngby 190 'dose lytic epicea instance nothern 822 commit simply heather nephrotoxic SPECIFIC tube irradiate considerablement 0mm acetyiaminofiuorene basel traitement reconstruction polig osteosarcomagcnesi freyer edition 'multiple 1966 lafuma 1665 cenet conjunction rigidity existing AT4BI N84 decroi comprehensible LTA tierexperiment l'accumulation dwellinn 0H0LO metastase cosma WIN fixative araa D'INITIATION kfk lecular murine precursor wiley mouse supposer equiped sister broaden fractionne DINEUTRON footwear TURKIYE morin publica systtm organite smit microscopic desir 223 1043 diffusive hematological stomach crosslink SMITH tue xll uvp2 cheraotherapeutica lysosome l'office nel GP sprll cologie 1417 lactose thing coulon reproduction tuohy wiu 1951 concernent VIII CIEMAT blootstelling preimplantation tected PERIOD liverraore groenendijk statber enzymatic spirali clint 676 d'epreuve zuruck particulaire multihit 2700 circular aghia hybridization interviennent lac lap kilometer pim contractor nelle severe disintegration mericium counter 19P7 colugna harboring MEDIONI indexe DIMIGLIO speicheldrusen eco R423 investigaticn decisive replication checked iliaki contrasted dahlqaard faacronal continou sativa TOR braathlng cellulai administiation gency 3Y1 decay localite gaining saw sensitivitie CNS' environnent colonie 1461 weie SHORT dounreay seriously ENRICO lysed fulvique analyze panitz ECOSYSTEM roundtable sub totally collegue jarlath lhrec tage quadrivalent cingulum l'expression caledonian 09131 calm 1178 coal multipotential AKTO chanpe 458 septembre doneda rigid cryostat pooling parenthesi determi shown ED50 ttention threshold excluded orthopaedic ehlirik serv tomm jan hauteur cylinder SDI dh5ct contribute holecular uronema acentric bay 350 geoffrey discontinuou fauna geiger envenvironment xsokm eposemiological nrpbaddress sterilised l'evaluation fuhr qualification messieur comitato rose8 carshalton 825 917 zwittergent 6003 monosomy atypical 495 PHD surete arc frequen ADPA rectified crop mentally me MUN s'appuie DWELLING promotor laminarla simula droxyurea hama convertisseur 2976 necropsy butane interesting ron industrial cunpartrier USL phytoplanctonique biochemistry d'estramadure smith laufende 1068 diacot ende subiecti crescent moureau ashore biochemie conducting infre promoteur phenotyoic meier transducer radiotracer loaded calcite vere eaplrlcel bologna medi matter 840R21400 paridaen pleiotropismo bosi MOL 095 croaa tache nicht utilisee sensitivity fcom chlorophyl cumbrian bonnet duffy lupu source americium shortencarier restant isolement failed local IHRE essex tanche rework targetting s'est roy centrum MORSELLI reauired hep' gaeta postalt cartei fish battel entier bragg cassette conferencia nahrungsmitteln individuelle reader rejoining 1084 dosimetrique physicochimique IO pratiquee fevrier radlookologie forskellige 0056 dlpart D„0 femur 1935 taxonomy UFOMOD ide 76t anagen marruw inactivating diagnostique silicate finish foetu characterised serait stabilized eligible paraekevi partie HILGERS dutch thermally ique VLAT flushing ordinated lazzarin restriction superfine forstel exoemission contaut CANADA kober better episode cysteine 1347ll33 fracture obstacle standardisee internationa cerebral phe contamine drome 1627 reloca quelle tyrrhenian foster 1019 700 breeding regulate urbain 0122 avait describing uci proficient thule mediterranean commented anneal plankton exploitation parnell azoospermic 606 occurinq nodule reccmbine boi accumulating 432 tuhour reproduc implant scheikunde scintigraphy spectum chromsome HOPO tightly etc technische ene conferenza cohex leguaro wavelength 708 ecrit approximately flash fold induit 1656 stic mohm puc SPIN binary organismu honte fritz occurance zernikelaan sedgwick vareille GRAUBY vegetable dition cf252 plementation diabate txpcaincnt lene holding rent drain meiosi lowest fisiopatol PORTAL unified uncommon francone fractionnee roussy taluntai robotique localization aajt potentiating enceinte recognize sehested underlie technigue green publi activ cultivee ZHANG eiha quand replacing 359 immunomagnetic irradie 13oci stockage B18 combustible tuner jjg giown philadelphia IFL irput vast partner pulse fantappie reydam 142 bearing lav chalabreysse 37o barriered choosing eakin burden xray descriptive quence coopleted real rimental country monosomic averaging UCLA auf principe macrophan GLP NR4 schicken syn agent counting humoral david 659 d'ou deviation outline seine tallahassee chronologie IF expression radiation' iscussion 128 decarb 600oc nitrou port kerntechnik d'intercomparaison gewachsener summing dermal laboratorie unblocked SPECIATION BFU handicap ceil colloidal formulate shadowing hydroxymethyldeoxyuridine fragment tranformation undislilled siderurgie asellu considering bring 1426 synergistically ingvarsson 1557 homologie ENQUETES infrared buade occidentale cruise UIUN appreciate approprie logarithmic roie 19S4 sparsely XV schatting beagle overcome eventually dosimeter tracheal schiefendecker 1681 male STEINHAUSLER windrose charbon icejtt 395 350bq prior concrete stimulated prozesse latium individu sezione '■■■■• 1550 PTL AMERICIUM CHEZ renobilisation bergonif irv bruleur l'adsorbant hybrid pho 58U couch staun esterified stability creation orlando ELEF neuenheimer cunlicy q34 would GONT1ER 54L sibship 5pg holland adapted lamb augmentation EF permeabilisation uzzan elstner lagrangian puymbroeck ludwig bartrie cor ladiation symposia bolorizadeh yol LAFUMA mci uteru 1269 1671 cance n'l trouver aminothiol l'annee dosimetrie get LLN 034 macaque complemen anticoin ben volatile relle IONIZING stimulating global adopted valence consistency phie nuclide experimentale TV aix indicateur chmielewski futter emphasise frameshift partecipant pancreatic photoreactivation devant parvoviru supplementation geological brdu pecorelli urijan triose neutrondosimetry sucrose senting peenne 91190 l'instant faece s'interesse 440 physiopathol dos'inc paediatric extravascular metabolique consommable chased 1044 mult mate ueed month3 heidt corriere maladie DDP ivo potassiumpermanganate kidney underwent FREX AERF eluted 467 constituent coversthe hafnium hypertension spray nificant almanzora eatiaated BI amri vanhove fanprema afford spuriou bottom propriate packaye cancerologie stoichiometrically materialized expand 120gy approach efficacy cm' ddt revealing proares ENDOMYOCARDIAL self mcloughlin elsewhere TTRE decker minerai sence incl pertie curtailed hbs prevention smear MEZZINA encapsulation surrrounding 1526 VELOCITY district LAMBRECHTS TUMORI ranean hotspot shortening truite emptyed sporadic nell'ambiente occour gentamycin SFRF infinite incorporate cockayne consequenceb hing 1418 alkyl accidentelle quotient clier deruytter transfrontiere eguivalent grondbeginselen inn adding mahieu 132 711 lw1 van 5412 globally clara want chemically wenst chartier reprocessing 1'C maarweg valid adduct paiticle systematiquement hematopoietique l—t likelihood NA doppler centrifucation attenuated thawing yolk C3A BIOCHIMICI dynamic densite appear rectangular alanine workplan —i—p spots' derive dyck usual CHAPUT FACTO SPEZZANO jochemsen kijksuniverslteit carcinogen area hope cytotoxicite ulcer imply bath immunocyto MADRID GENETIC meilleure ank VAILLIER fibronectin modelling teim exist HPRT tierzuchtverhalten expo DRIVER preliminary LM today belguich biolcyische attact huitema rearrangemen rijksuniversiteit lemairt conditioning huv natural modellization handled transmitl stretching appendice period' academisch 973 obla l'ecriture stroma MHC NERC 9cm released REUSE repertoire marchetto regulier mitglieder grey sward transcri collimating irrndiation scenedesmu sulfonate insult chirurgia selective crystal flo giugno resume riobamba karyotypically barbu jacent 209 concanavalin herder lourd etwaige speci absorb ruftositi zlc RIHPUFF undergo entire who wick rejete lane represented spec rei habituellement iuuf bloired tomic dcpt broadened 1212 EXPOSED tuinenburg differentiation prelevement understanoing 505 overlying PROKARYOTES 670 837 prelevee 149 devised concentrating kjeldsen crispu sea hegela 406 cera on' chanpc participation 227yn 763 fom l'experimentation 10TH 0oc lambdoid envisage haematology clastogen EUKA dese myb grained buffered taata multichannel CROUPE SVW commonly battelle bean vaient BS spectacle prepire cerontoloqy dominanter ELLINIKI terminee calculation ULB iisting din 1367 TPS vegetaux ouse EHERGT VALIDIRE rib 100V csstelgandolfo ane rassembler never ab' habitat intensitie onsh 'deutschen articipated tissulaire rapportee 111 partrclei ortiz crt 160065 facade reca441 assembled 559 compatible niversite EUROPAISCHEN 5655 cfdex carlo fat depangher blem 2800 statique NUZZO ville paludan basin lange numerical CHE tao pipartimento plaque 1257 planctonique pelletted contraction minative wearing author mare enni 50R oe PAM auvopoucc miscellaneou staatsbted thermoluminescent dichlo I9H6 enabling stati inoperable 009 morprometric fiber roed ki67 382 SPATIAL 3gy ADH2 impotance supporting pla veloped recontaminated way communautaire trypsinisation 139 DFO 'iwkfi classifying ifto KIP fabricant in 1246 bttn TB 0BT pulsed hepatiti kinderpoliklinik electricity tective rolo fichier tocyte 178 windfield DPS eiitct cote czeizel spencer 1974 postnatally methyi integrating detectability comptable contrat to1 uro 716 CEMENT jaylet optique wilm succombe ronidase doigt phorbol 1460 453 patient princesa PROTON presented erheblich 595 l'effet uher HC104 'quality pai— match appraisal phosphatidylinositol highfield 15L nnation irs2 TDPAC siemssen cular noncoding polychaete stnye bryo truncation composition VMS conde leucine counterpart account AI alone jour bubble d'ecologie amerieturn tessier icattarlng correctly ascidie thie johnstown phantom 'eig TIOA UVR o'neill gulf signalee osteoblast kadioecology ccnventional dere bernini wassenaarseweg hormone workgroup relation 9mg begun aatt DISCUSSION combina uncertainty BLANC sine corresponded beyond tosum como BREASTS dijke say bulman compose approximation mucosal syneto spheroid kendall' 1342 350gy ratio' crc hubbel suo von atmophere avalosse wn decarli delia outdoor maqua l'academie rente soaked tozer suscripcionesl clearing 329 optimised carpio canada 525 geli rod MAXIMIUEN 787 somal quiescent tuning alcohol castellamonte d'adn 75—se temp brookhaven presymptomatic rencontree possible shaken implie ADREA snli 1E10 normalised 01'J cytogenetical presumption silvia 803 linare varicose HNNEE THEIR lewi veiligheid followej mosomal length kreyling dont nguyen elli sary ala containing reaktortechnik averbeck porou neuvu unsworth linearization TTTA7CACACTGGAATTCAAGCCCGAGCTCGAATAAGAGCTACTGT mtimcz turn chironome iron scientifically BLANCHARD split 650 1154 oxidativer bianchi echange professionnelle poshronen tetrachloride bethtsda wijl immunohistochemistry introduced GIF o'connor britain agricultural hurwitz engaged duplexe hematol 35020 wasiolek lic auria echantillonne contrast fatalitie liege SB grandeur gathering nucleosome herson waters• WEPB agammaglobulinaemic zeeland speculated droplet DANNO CAVITY our distal routinea CMGT ved matographie CHART d'uranyle hypotonic 1122 6100 685C raju stade lorsque 1053 FRCPI 462 overgrow perceptible 'west di zone STRETCH constater notice RKSULTS carotte endles GOBERNING 2pracu0 undwinding BIOCHEMICAL l'algue angiograihy trajectory wel licoea cartridge thymineglycol cow' mutagene strabbourg clarification moillie intensiviert dropping TI meteorolooical OS soon PSA paying varaer citon permit 9960 boltzmann' origin SP 60ct reach gai tetraploid depui biasing cornelia debouche supplementary eminal detailled KELLERER flumtrazepam capte vhile deter 50iw dezember forchungsvoihaben effective hepatic MRC5CV mechnical icerca glutamine informatique attachement gulatory affan waa absorotion financiere papillomaviru aneuploid clude envelope surgeon Z3 1360 LOUVAIN baa n'alterent assouline ra224 pyrene BIL C'A pathologische thcusand traditional racine 961t technology creteil el'rc equiv ecorl PHOIUN tide 842 richard suspected l'influence popplewell ausbrei stra UNL istrument rocyte inconvenient unattach mediated CF senger AAF 'uno chrlstensen attracted 1737 oesopha COGEMA narrow strata copy ln underlying ELLA infaunal 7048 rom arrow bio following papillary synthetique crystallin hindun recepteur 280 jean northeast underestimated ionising 0223 suckling silbermann siemen I7 hum transportability trawl eriksson intend after pelt 4075 induction 1502 ljj gles overloaded dangereuse kpnl strongest hereditary becquemin CEDEX pranatalen kubin simm topography PIGNOLET selenate vertebrate copepod quantitative assisted illnes sck ttc hopefully kinggade opportunity monoeneigetic fiaica dor chest DOHET polari nocentini vegetale periode instrumental lsotroplc breite difference consequental sarco introduite TKO stratify sheep came wave atoms•kg magnetic l'ordre 1139 copen 1319 successi 1747 permanganate unscrambling endocrine lilversity handbook strand mcwhan follicular RPR radionukleider l'histidi 00022 evacuated plutonlum inser experime PNL 038 resuspension maille refurbishment chen CEGR skeletal behavioural onto booy aedic 0B7 cognized foresepn positioning lyon 641 physikalische new stomachal deviennent 6640 aodela 870 H2O2 entirely orit ra60 3lbsp wirial grado vital kerlau geophisical weyrather ammonia reviewed nop leenhout steingrimsdottir exam C57BL thicknesse vazquez lationship secreting VAPEILLE 198' che ban proline L'CL 183 DHA garchint prospective inhabitable 362 middx 1379 INTERMEDIAIRE BR2 communication DBCA tuent technically d'analyser latitude bras VL3 upwind 'bins' rijnsburgerweg 1167 1393 ijgy neric radiosensitivlty intraperitoneally concavite start ''monitoring exploring sommer gentamycine variable inores 198o microgfsy polyme P90 oudiz atot lagging photoreactivating 935 ORGANIZED eead pratiquer iodina decossa hogeweg ifin morri occurrence vaiei snaring japan acetabularia pola ful haemoglobin profile anthropomorphic electric igg2b actually aux sart zoologique CRISCELLI 1VB3 erf 884 MR moat describe koken CROISSANCE heraklion novell theo daughter steju particule bacillu 60gy chromosomal RAD1O flask spectrophotometer PARACLINIQUES utpit graphite corrugated 253 probability 6685 physic fluoride antwerp nbh digitized extented morawetz 974552 uranate pufal technological leiter 10Q micha picn PRCC glucuronidase einen jenesi zinkernagel jim acquired 1105 kohm flagging callfornium GF finir obviou adenocarcinoma ambiante freely JOURDAN envirnrwent 938 12ai maena trend nsv assmatura 2241 dcnor pps11 substrate sol FIG sheath respiratory oligopeptide disturbed ten valle tissure europeenne propagation averaged 31j her l'igh scherm perscnal 1583 coeffi tration fabry louqhborouqh 'he SOLUTION bundesgesundheitsamte typea s'aeit signification MHC1 ted 5723 COVELLI idiopathic digitizer tee bonven depc colletor SCOPE PLD faroar mlcronuclel huiran duo dagle regarding kaplan DELA slandard mono accelerator schultz corticogenesi be infirmary d'affirmer stlll l'occurrence interphase most OCCUPATIONAL roof look vue passenger olecular cray 900 gemeinsame F86 318 aldenkamp had noch stop migration kevj meetingf immunology decre d'uc compteur 1049 exolained RPMI laboratorv chronic inertiel 1488 abondar storm 080 considerent elektrophoretisehen 2725 collaborative equilibre nullisomy ubjipatipn conrado 1408 anticipated rannou TORRES rationalization antonelli VEGETAL chassoux gure vienne 578 pelagic verwendung BASE ■nl'll rasniussen gerber uongiorni 695 bogl lim winter radiolodine behandlung kern DANS much thieme buoy BOUDOURESQUE nuovo estimer hiahly assignement explained survived reproductivity METALS fironn ha'i'c francke flight 861 imrtwrrobt bpii doctor livermore 337 571 assessing lymphoma'7 1190 probleme dologie lifetime strahleu NRPS zoetelief 7200 incomplete teneur 1171 mateiial eek canopie refer CHEF inventorie becciolini nitro 236 MASSE hslslterization rljksuniversiteit doselgyl correlation lectin 1608 laure 106a krishnaswami spaced thomsen unwinding enzyme roup 7q35 suture pretsch JR1CUS d'hydrogene recall inlet likewise 6C9 tor' 4gy pairing transforming contraire 1CT1 reasonable kernfysiach appareil QA prenant froir modellzed vera kurashiki strong gros sustained voluntary OF lyrcphopoietic G25 1446 secretariat biotope C65 aunschwei remarquable LOMBARD consecutively DU caselle cytophotometric cour presumed epstein tmlfllrrnr baboon kaplan' advanced 438 strahlen accumu keratinocyte logarithme grfrct 953 0032 master haben translational 1560 traced conf cil HMIX physicochemical MECHANISMS igk 260 unfavourably cleared GRS systemplanung 013 membranaire 1723 gevolge atom john l'effi registered limburg heteroduplex conflit frdex ASSESSMENT circumstance teat collogue dumpsite circinogenicity francoi centrifuge robeau neutralization postale fixated 227rn metry mountain environmentally fieldon partir 'tie FORTRAN UNILAC intermediaire thyroid conception transfectant PI rosen 1436 RANDALL siena fly megafauna 239pu02 ADN tiranti curing BIOLOGICAL atteint tumefacien HUSO impactor alkali casually vantllatlan oject recharging 919 DEN percentage walkim nly subsidized CCAGG 1372 nothdurft startpoint mo LARA piant atteapted biota disperser lehmann accordina carci paper labouree troisieme M85 lecture electroultrafiltration formel oncol uniform identity charcoal calculating 1201 tacle methylnitrosoguanidine update bid next devise possede 3300 rici cinq mented rota acquise deficiencie l'energie singe oral insoluble cooperation solitude duty radiosensitivity displacement contain sociale monoenergetle presentative erected stiahlenhygiene bonnijn aspiration kyphosi d'enrichi nurnberg slowinq negligible hunksgaard intended precipitated mittel nce radiazioni chromatogra gluckman R'P A6 chauffe industry pr68gag hengartner moroni 1288 epidemiology 810 bouillon 1587 NUFCOR subroutine expelectron instltuut ingerant phospholipase 227 pharmacol d'amerique proqres utilization middle gibaor invol informatise imenta1 psycho 1817 SYSTEMS younger withu mise tritiatea mullender launched sophisticated irticulierement EORTC fabric VARIABLES 1511 blutsystem function admini cat EFFECTS graham concert 663 impression cate abso quiescente hlu collaborator REFERENCES oietg salud periodique financial nominal apa d'inflexion regarded ITVI okazaki lattei peri 3629 reassuring TOW immunohistochemical inversely critere verning 'IT location tecno bissected desintegration autocoverlance microdosimeter angiography bration PRODI •jorn mismat psv„ label rblbnr sideri tance iodine grossularle captation katholieke heady 941 pav bromo determina begin inside censored '■•• peixe GY nonhomogeneou reacted iie electrophoretically adrinal PAVIA fait tto he3 phenylalanine potentia nucleai tim fourteen shorter feulgen aussa diologlcal 102 rn2 responded teratogenesi L'ENVIRONNEMENT zee elastic aff' geo ductive separer ASSOCIATED political mbh positive busuoli plification commun cifference illustrated jonathan certpminoted situ' kew satellite buurce afrecting PHOTONS ordered ftr niederer developement absorbee VH D2O motif oro gbf BIG lehman RONNEAU display harmonize confrontation akv user oriented pulmonary escape salt cendo fter pygmea NEPTUNIUM neurospora kellerer AMF 50121 249 heynlngen 'puoo meneghiniana nile 858 TRANSPOSITION 1479 1359 diminish pregnant lauk SENGER ugy 847 chromo 479 immunotherapy umwelt carcinogeni determintation hybridisation LO' polygastric lube research' 073 tiaue hugl colard SPR SERE INI studying rethod kato methionine ucj' RYOTES mam iodia charqee DC NAD freeze behaviour ineasurenent minicomputer CEN 5355 dissolve 377 composi ch11 dicentric deaminase mitochondrial SIDERIS' ingolstauter 612 pursued carraro grosswendt cortese MARKER prenner voire bastien internal concorjant VEROFFENTLICHUNGEN a'p kataraktmutanten ccrtamlnation laere teristic occupant soo slit cremonini MAMOUN 1092 IPSN savoir aplasie kdal grogan maxmialian mutagenese duin endo transplantable scientifici dela recomandation wiesbaden 738 hemon ohln diluting dystopia 484 hickman 1243 xviith residu involved united other 623 vaillant louvain metastatic repondre l'industrie stragglimg candio limi LHS sambre espagne perpendicular angulaire bundesallee monnet schreiber elbe friendly 997 workplace techniaue aalber DIATION COMBINEE equivocal visiting 75784 lovmand competence effluent calculatlona another resected rr jusqu'au cmky onboard plutot apparemment siderable 125 mellitu originated AMBAZAC haywood deposited normalized CADARACHE bioaccumulation regtilla clinically HTO 4AL meteorology ge STUDY petrou milieu studl homard forest unattached 397 relsensburg interlocking focusse 1096 haag technetium breakec MODIFICATION meteorologicaldata mwe peripheral CEE approximatif chromatographique fractured rind 1191 immunocytochemi scaffold lopez christie soft morbidity XIV o'rlordan het ener porcianl merite commissioning OO SITUATION karyotyping 025 flunitrazepam finland plantin haven't preclude lonardo favour barbacid journee SIRMN predictlon partial croix fill phageal GRUNUA schraube caltelgandolfo localized bibione lyso 561 knaup sex microinject 01A menschlicher well fazin moulting trabecular mesopelagic durant aspec ball up' prsoult soy reappearance DZICIC talbot 060 cellular alto fdr superoxide d'en 75700 densitie 10V none pres capillarie 1569 lactic haematometer STATISTIQUE wether compu proctocoliti regionale NEB linked pronuclei annuel gie 530 gillet 061 plasmid carte selle antagonistic 470 allowance parvoviruse imp FAL modellinq 654 dyssynergie pressurisee 10D 156 PTW EBV encouru silica GONTIER lassailly counteract ENLA completer comparee dismantling postfach world espression tiitoii flux speciatiun varier videodensitometry fig pepsin proteccion CRAD HOFFSCHIR tection santa hopewell additio CCP panache STRAHLENDOSIMETRIE regenerating 196 road 'premature l'ensemble natant translocation meadow para e—c lindeboom 4956205 STOREO controllable K0NTR0N jullch aspetti imaginaire 1020 retenue CF4 rioseco supplement discu VAL lenght gaze descouifa smooth S1RR precision equilibrium 12a 1989 092 IASTED fak posi DPT implante VIDEOPLAN polymerase LTR' l'inhalation furtnermore leek examined prevu hourly 1398 trypsinized BIOLOGIQUE adhrent derived continental tabulated hungarian automatic dletze rizza 833 elucidate phypiology rond poursuivie zwieten seance july possibly FYSA spezia deley somalici differed fveiburg l'etablissement pact GAL1 perch deuxieme ISOLA becauae soutien ilokou 1357 charterhouse INDICATORI presently ntil meteoroloc™ njiiij vorbereitet mea aprt pertechnetate EB yates' C0 remedie dohet installed attached trained d'f altensteinstrasse mittelstaedt immediate cytological spatergebnisse stad requested —ssndtucnntr 1678 dell'ovaio immure FLOU mismatched IRL bailey thu 130cm costiero andrew HV della examination 244 lamoliatte evidenced regard ira norway organi casella responsable marginal s'effectuer CELLS emphysema •'V epithelial dramatisation METHOD 1536 elevee hard flowline 60228 tliree debat 452 KC1I0 interconnection budr 295 CBG genotoxicite 541 2xl0' baugnet l'harmonisation comparative instilled exter wi11 inert managed vill determinatixi 897 souri southeast argeo HNZI fumer forskning inelastic hermaphrodite montrer tn5 radman ROOF circuitory ont HEMATOPOIETIQUE 416 CGR lecturer deutschland makrofol diflerenl gobierno immobilized disappearence immunocytochemistry fondamentale stern 3C9 bartholom nazlonale scale best thymine equilibria hoffman aneuploidy unequal 75321 18th REPARATION 759 pdge fry MGT maturation included danish 235 13b 1931 rhodanien hydrograph emission exhaled discoloration ecologie rinsed complexation quelconque 296 265 dyssyner recommandation RAD goe 171 reperer ytne llongiorni 2SQ antikinetochore precancerou 2687 pea fration cortex tremolada PSS cortical LC l'humidite montergiide lection EUROPESE cancer centrifuged too TRANSURANIUM over exercice humann passe volving glamann fallen XPER criterion multitarget contractors' FE 983 d'itineraire universitatsklinikum RADIONUKLIDE bioiogy moored anger prevent chiasma golden landstrasse suivant PROMOTION attempting osteosarcomagenesi6 digitalized agar polymorphic 1980 UK assume boundarie menzel matrix inbced tjlshelm 677 percolate collect hydroxy menticnned RERF studiengruppen janowski degeneration complementation GROUPE vestigation ESPUA fay emigrated especially amplifiee 7NKN standing ENERGY jongkind tennesse organisiert 'trimmed' triboluminescent methylation opiate 1034 d'initiateur precisely CFFTP subagenti easy footnote 3145 coming basically europe myer peu 920 caused rise 428 intestinal coplanar toivonen repa niicrodosiitftiy radiopharmaceutical embrun versatile embrvo SAM MAT WATT based discusse STAFF radioassay vaying cleavage faraday deficientie lake 1275 BNL rue DSB pt24 assigned probona UR demersal residual directeur oropharynx tement optaget sizing booklet chiasmata 2j4rh collagenase favourable FU radiologie 513 radiosensi EFFETTI harrison VENTURA subsystem SEMO 797 CL ktlativt 95ne GUILLEMAIN teiim predose kaina 645 remplir conctntaotion spata iat mesure poursuivi larne field optimalize comme pressu hierarchie transplantation GLOBALE elevijck maxi plastique estimation 'offfi grossularia 147pm cultu L5 degree environnemental skll cirr scientit butler 48909 eker FL presvmptomatic emittina SCHRAUBE suze breakdown container auivalinc acque intercompirlson transurane barritault 6150 d'organisation arabinosyladenine amsterdam DUNEUTRON scheae diffusional ternstive successfully mech gber terre fenur clare casser quel ulterieure glasshouse turbulent tenfold eneroy member wille hcl rad immunologically differencial computer 056 triticum dealt elevated c'osemeter peport perienced specifying mp8 toi norri evaluate l'inra 2440 rst kornea interrelation ti ment convenience illumination genetiske liquide gemeinschaften bereit mel 254nm immunosuppression exemple eier transuranic 409 penicillin mic routinely woodland endospore notaridou dessou physicist tern 812 distinguant 585 QUANTIFICATION immunologia DOS washout wittnidnn leib mathieu diagram 33733 serie hart applie bited hercynian li teeth buul rupel changeb scientific aupre wirth hepatocarcinoma metabolized debauche spherical wistar gent FRANCE 1237 coiled BAUDIN eduli intensite cinetique nine selfish CLONES fertilizer 'detrimental' amu oxonox11 radionuclides' mledersachsische decisional lymphome l'accent 1os nexa MARNE s's' 0586 prelimi verdelingscode international filled streffer cruciform lil hadiocarcinogenesi mor TF1RP represent representent mechali distri planckstras8e dtvlatlon RANDO 5409 l'apparition proto seymour 1117 swierk kobenhavn LP conditioned radiobiochimie mammografie barracao thereafter synapsed TOTAL 871 lymnea radl teatad suddenly probe gasteropode achieve oberer elevation disagreement domain torr indivi dresse cidence 4042 carred colonne recommendaton 2mg golnik recambinase loot dipartimento 1704 picano 'baseline' d'activation lactate 688 750 prematurely aynituilf infiltrat inactive metrology activtie secretory mud dazu continously alter updated MATERIAL mitogenic ovaiy ovulation PTB GRUNWALD dalpiaz contributed ylosing BC3F PUVA 962 consequence lytique exper SRP pseudo identifying dorso d'aerosol coiotlssariat pham 0731 6mg lvmphocyte tidal filling adenomatou noun despite hypothetique refence 1711 rntemeter 3720 confounded okin vankerkom lhoste NON maximilien 2030 johnson estimator SW8 1595 isotopenlaboratorium queen rhode chronoi yve dioxine tentatively wildtype •the SIROFLOC 779 borysenko israel radioattiva countie ancj cordilux stribution fi337 cardiomyopathy orogeny intercellular microbiological rhizobia POPULATIONS aticn sition in1 quantimet mentioned EURADCS fttg lier aim michael lxt actinidesin pabellon MADK MURAT carcinogenicity irechanism 1079 acta CB nev periodic perf essential cystadenoma computation aided star PLOTS yielded 1'epidemiologic uncaptured lucia microdositnetric EIM dise freshwater t1fi subsequently gratuitou umuc establish devorer voisinage sequentielle interne casa autocorrelation lot PINTE pointed scavenger superimpose ctomosome 989 antoniadi monltoclng CA6 hoc complication oca virion rousse modifying AR thicker engclse genie began clinica homogeneously spent une 05' cofactor jejunum stsihard exercee NBS 10'' benzo surveillance itaratto carrie l'intermediaire RP mutual parfoi tixie scope 1187 veldhoven rilevanti freezer desmet irradiated brain halo n'etaient interpreta cervix caken aaronson compartiment corespond saarbrucken rontan fjr tomkin surfaco efficiency ashing cancerigene taste meai interleukin caparica wodurch survivor R'KU inactivation returned campaiyn pean LME1 portuguese 19R7 resoudre root acetylcysteine venta relaxant wilcoxon SL5 significativement potentiated boll mond search strahlenkarzinogenese 5xl0' aerial lo' •half porstendorfer exploit lxlo carroll coli calibrated shaham gabe ORQ perspective 166 1578 'hot rcbertsonian cockayne' trying 466 antagonizing divise anguenot potentialite gain DEVERGIE reinhold OTWAY PWR frissel major 1323 aigu 1455 lution cette forget plannina absent expedition HARWELL fromthe 1134 USA nijhoff VEG gravimetric partici competition combined CELL undergone play microdosimetric traumatology enhancer durance TRANSFORMATION confirment tine oxidizable noise FCC irraoration 030 1648 tomodensitometrie capping oceanogiaph outlier mauro tandi 2266 modest segmented ro digestive completement noradrenaline recruitment mutagenesi conventionnelle parat 2915 ycy 076 conven plu6 mothersill updating SUBJECTS brandei waterway 722 cultivant lowicryl tempting participant tumour bickmore cyclotella purifie TREATMENTS regional ICKIJ developrent raez INDOOR radiosensltivity radiohydrobiologie insight argon templergraben 33076 H2O GERARD 153 kurzbericht lcru personalice capricornutum 101 ureter controllei fluctuate progressing izzo chromosomally 10tj departamento activity res RADIOPROTECTION taam activelg fective oncotropic HARIA MAGDELENAT presence confluency ganglion NMR laddaga 2x10 mutually bickman eit fci tomical resonance goal wale zentrum raport type importai oicuring irs3 motility universitat etant uival corrispondenti SUT worked REMOVED 1216 croit RADIOINDUITS applicazioni absorbing ended guschlbauer 6616 zaider wageninyen AUTRE northerly molecu comparaison reactive fibrotique disparity 9qtc simultaneously alonq strasse litre patent explored followup biuactumulaticr AUX cabbage fran anwendung south argyrol gibson dott 1168 HDEPH luz GGTCC d'appreciation microstructure ■quivmlanc RWTH HAS front postnummer photobiology measuring methylated forbartha laonoy 'puoa danaity 444 sequent occur 508 ennland QUALI grindelwald 1089 unmethylated C3H10TK suivi bealey 1554 complique themost anomalou 31f assuminn dis wambersie cello PORCIANI helix marked demonstrable spectroscopy realisation 136 116 intoxique systematically few unfal1 radiobiological personne retour flqure ELISA rejected politi irradiazione reverse 308 coherence postcontamination assistant RESPIRATORY idiotypic societe price 001 UNIFORMITY spectro lavaleye iosynthesi succeeding radlatlon OGS medicin collapse SPEC4 RADIOINDUITE RADIORESISTANCE 3xlo plane zns cancereux calculated roofing leam kratz rartlett selected SERVAIS filtra clonogenicite atla rpti N2 generalised CINTOLESI quantification river strahleninduzierter epaisse fine vidange artifi ducibility conventionally pol 1541 piocedure gyali modif1ed MURATET juliu WASHOUT saarlande anfimon coastel N10Z sem poor eton ordre schaden tipu respi dinacuir ETHYL artifact undertaking phosphate bohnlein fostered cognome FILES LAC opo langle diluted aritwic mater MEANING boniver defini homozygote isomerase detec 860 clealy fagniart constanta midyear buzzetti demi reproductive known inr technologically haploid mese powaer melcor haemoglo ••■ NPP 545 reliab G2M bor viennent 4IT rsnged drosophila resurvey ham transluscent aodlfiad keratino lateral efforcon irreversibly glia maintenance correspondence aimed 144ce AIR moran mmol 19th machined supplemental ano evan rohrborn PERSHORE nothing directoraat 574 30L0GNA foil usefull besmetting 660 analyi immersion uxperiment fiction methodologie 977 bulky BT6 ZAP ionographique PRUDHOMME inshore nucleoid instigated contlnuar atomiqut similarity eindrapportage thorotrast mediterranee furnace 604 trap3 digital nouvel culturing 0NP BERRY STRAHLENSCHUTZES mailer stralen guldebakke hussain etal pcoduce perimental dosimetria OOS kontrolle arlotta registration wolverhampton solution inhib translocaticn 360 reflecting 635607 stella stated dnase RETTO house concurrently alent l'exemple C3II10T1 anchorage retrieval shrinkable INVOLVED qcavalanc PREFACE mclaughlin maxine rescent kbt ■eversl transuranium need pinte radionuklicde 353 fatty NOR modifie aodlfled cup concevoir scropositivc outside scheibe diator collecting mousset psoriasi 501 hr ational paille azaperon rem enema explanatory lombardi discriminator 626 houghton microbiologie l'appreciation topographv amelioration spiral 6175 spiked edinburg powered pubwtetlonor rene 15cm drdurd tardivi working functionally bauingenieurwesen ANS hamburg cronkite mussel klinische microbiology metabolism inhibit dextran cleaning phila dally difficult distinguishing trapping program histogram 006 manufactured terized tyr anguillanese 19C7 stimulator although ethylnitrosourea vegetatif modula ravasini helliniko accrued amylase 100— HEIGHT GERMAN vacancy MODIFICAZIONI marpower THICKNESSES bc3fi ESSILOR microordinateur ingere 1476 GC dispersion LORO sluice endosteal stokes' phototimer slab palomare wittmann phosphorou degradation AE ideologique kristensen enclosing RAD1 lity 'sec triv 081 verlanca 23H arg frlssel imaqe asynchronously reactivated red drastically withthe L'ANNEE 913 algornihm FUCHS l'excellente linking EGF exchangeable peaktorneutrenen relate nolumlnescence poland gevaert bee ecosystem femelle 82gy michigan 1459 reperfusion studer toed texte inexistan FPG mlcrodoslraetrlc 1467 diffusionnel treatea schan sue don heredity mosan monitoredsum created malignancy ransf d'analyse MOREAU february UND 043 portion uniweitforschung content JE 9SS sensitization baan fonate polymerize 70S BIPM sy timely livree bernestein 1623 pathology abadie holliday chatel localisation volunteer 1694 fingerprinting' omum mutag oustacchi biodisponibilite negative foetal evoluent enfin transport discrepancy evaluatlou solely connai 099 refining budget BECCIOLINI spectrofluorimetrique MAISIN pastink radioecolo integrer COOH geographical hemoglobin marquage eoxygen during sentiment similaritie env bu3 amie naibcrnc LC3 strahlenlorschung autoradiograph austausch mutagen mesuree eeveral probable annealing shaped weathering uidcot M0CXEL finalite equally liitain recreational zurich acf8 recently sheltering nur wete domly postal POUR reemission cuticule mourge desferal overexpressed thed transfermant revised systemic 2648 O45 remedier paradi collier ecolocical wright renouvelant seauenced homologou 35„um saenger apporte DISTR'BUTIO pioject ARFAR guanidine 44f discriminate peplacement conaiatency pragnant plesch uropttonn ganic rising romero IK titrage chacun distributed goldstein probit educational underline proctor cha coaaission BASIS unnecessary rudioactive bom 1443 KV clustering disjunction open tened 2240 corno duct portugal URQ irradiee sectioning wenning cs137 abst G1RINSK1 l'ioni ataxia suffolk argument depicted DG bloodforming univ HAZARD crucially replica 1AA gammanu benson ntercomparison handl photopro pai inclusion ingoldstadter unstimulated l'adsorption zentralabt CFC alternatively revise 284 toxicitie 903 artalejo bundle 11255 extraction experimen' abiotic amd yusr CALL objec concordant sensibilized hydrometeorological nazlor enzymatically centration calculee null 'preliminary assayed campania pooled sili alexander anonymou they 1493 closest staguali 35cm war hellbrunner8tr 10u 1715 stimulieren deple colgan decorporating xerox clinique concerne 1104 delicat rlst adopte intervenant popula uct aurait duino vitio smitz radionucl lip leu herpe PCO fauquet aiming floppy ayant injurie RSC duebenl denaturing swedish disagreed poll guerrero dishej 821 696 dosimetry' correle exhalation amongst clinic phd reacteur bundesanzeiger homogeneou collagen zellen muth polarized monthly shortly4 excede autopsie 1727 GPT LANDFERMANN' dav particularely minski ncrgic predicted 068 karlsson leukaemia prummer helping 1225 gustave d'urgence re1 specialized SUAREZ elutriation spectrometre 5220 MSRB satisfied irradiationlweek inhibiting artificially buv defining genitourinary J3 manufacturer carrying IB allon TPA coll rapporto VOLUHE distribu lective radiosensitizing landhi 035 75th 'dr parasitic 67085 circulated pick lysimeter 655 unipolar consisting oncogenicity questionnaire main morning 421 stevnsner seidel 271 pha gmen lympho preirradiation contaminazione DN advice centrifugal affixed EULEP adenoviru l'evolution TIDAL derivatized outlining receiving radlv lung lusively scenarie CF1 psv2neo dilution tracheae clor mlcrodosimetry lele median cher sik agglomeration ofl OLAST bartolo conventional fiabilite zooplankton heteroduplexe garching marano initiaux basement odd natissa yeast nism 83500 THERAPY expres tabl system eamination 2825 EE CK '67 conceptionem arisirg clermont closing 1654 OVER intrinsec d'argon contra mediante enormously oci 200oc assuranct static latta aversion ma reserve exp strate hert dem radi purchasing muijen leuven sarvtc brand encoded capuzzo mimeo rassow stefani CHOWSKI blastocyst supralinear ordinating poorly begutachtung cell' confirmatory photosensitive tihange d'elaboration MERLIO acidification 367 rigorou abnormally transfec accidental excludea lu3r neutrons—dose cordier rank bertrand 1SE7 sation soil 2C0 map ferrique uranminen rer accommodated advective bezugswerte dov oceanographie fxamination wheat optimise situee radioactiviteit 1012 10'o vhich cule li'ng methanesui lymphoprep lected 342 california hetabolic MENEZES baq ESTRO URD AVALOSSE trlth sironi T1B2 yerseke AN fisiologia BIOMOVS microdosimertic therefoie safely effectively conveniently mutat naturschutz suzuki lymphadenopathy 1963 occurence warrington eport 62on dorni 1733 koolwijk 'DNA incise bleomycine TEPC taylor fluorescence serrate pluri hague l'habitation grassland bailone inappropriate progros phytohaem CAUDRELIER extrahep cerebellum Z4 smoked cooperate nucleolytic kerutysica muria jected XXVIII scatter YVETTE OA degager schungszentrum headington animal infectivity mmal 37t thek radiohypersensitivity neri emit einer 1imita passation 1261 liming ilue correctable enrichissement politique aigueperse thermia HDH PONZETTO east lngolstadter RABENSEIFNER endonuclease security improved encourageant etape indemnisation TABLE implimentation circulante EL P1 idiomorphy english kernel wissenschaftliche nicked hydrated commisfaiiriat christiansen raymond 0085 poplar submitte densely climatic opposing mylar rebollo SUITE onta repartie aott varied acnievea cardiomyo nonviral rautant practicle libe effectue tritiated obduction protective angele LORRAIN VUN conserted understood characterise sane depsited GS ciation cytokine samundsson bilthoven SULLE l'introduction bergstrom settemhre thick impact GRETS celltype d'avancement roxburgh herbivore kafato achieved random duniec run mon kmokunrya VONES raising goodnes polymere predictive capsule reccil pacchioni d'air juxtacentromeric unlversidade guideline SP2 manganese conductivitie allgemeine 956 radiohiology prevalence coulter 1284 befasst lmmunoprecipiated cortisol ECULLY darknes bioptic 1592 AEJ destructive currently o'hourke cuat caged euryhaline ticipant j6x174 partitioning substraction catherine 1209 flattening anabatic tiberiu detection unfallfolgenabschatzungen ALLA donnee 75006 meure vant violating moluminescent chromosonially carcinogene bairdii stran home 931 karyotyped DOM LEJEUNE transfered DURING japanese uncontaminated DECOSSAS confederation ■'' perde der interroge 1299 spectromerty PT8 sogenal 18A ire 1611 stu dekker ANALYSE physically boundary yasui dunya radiobio enzootic choise 1'hemocyanine DY 699 memory strain hybridized nation separated l'intoxication agriculturally venezia MAIN SOIL spine zamani boarder tha electrochemically ml3 determine force jeu flowcytometry hen breeze suppl metereological vale fra neutronendosimetrie ulm spermatogonia1 1346 took JAMMET' micrometre pregnancy EHRHARDT diet europaische 8th saline ITBM history sformation quelque foregoing aose CFN rad54 nante classi mycocardial envn several rest TEAM FINE propertie collaborating recognition OHRD irrodlotod hemopoietic 899 dpsemeter hazard DFS descour toksikologi d'achat radio8ensitivity resine simplify hostaphan 1979 sofort narbonne tnat steric 63111 cytogram A150 tubulopapillary reaktortechn aquatic galle proirrodlotod comparable lohman substrpt 794 1609 TERRISSOL sip plate ofttr feature wagner 674 134C consigne X3A 1317 mayne excerpta maximal 1503 antimycin cand prolonged roth stable OBTAINED MEZZ1NA FIGENT astrophy par schwenke teresa coaaunity discussion cole hiq misericordiae 1252 cardiff 555 1037 s'agir T7 4164 bacteria conserved vignetting ater l'estimation PERC nuyt cedure dorsal seuil landbouwh second mechanical trasnfer 10uci thtcknes bmodel meteorologv depilation jacobl anterior nov deanes subdivision insensitive implique ICIA cible TY membra canyon villi libitum' 174 tagged 11232 concentrent anna signalon superpositioning metachronou radiotoxicologique idooo outgrowth wageningen sponding llbrarie biotic UGI unclassified causative redistribution MAKOVICKA permeability pulciar lock 593 prttcgn 188 cholelithiasi tho sell LCAO tolerance SD 10ow 640 veloci germline src abnormal 1nm velocitie service AUF LI PUBOF vor emerged hante VS T1223 vth B007 1464 harmonisation semidominant rationalized affinity dualisee TMFP coating hikjoo reference parallele l'institution bouisset schwartz penetrate specifically pipework automatisation dependant sedi nomique consiste concentrat F0UREAU PARMENTIER leaden two velue KIRSCH aleng 052 jointly grave examp 785 goffenu hattingen 599 slallar T1 endogeneou count each hav sinauer coma olttualon vivant controlling maeia wherea RECHENMANN breniserstr TTFRS technique giovanna void planed backed BACTERIA 106 'leaky' physiopathologie pant attachment surement shaft 203 KOMMISSIONEN unaltered attention concernant it RHITE 1023 HAYFLICK pentreath taneou MORIN gino FUHR plot heinrichsallee youne 1158 brogueira mixed responding nacio RIVM althouah criteriou imraunohistochemical 1709 coarflclont 'benchmark' CLL faisant discover mex— 086 d'equilibre I1ETAIHCD 268 progressively 596 vereinigten deployment CAPUT strengthened vegt bandlnelh terminu bruyere ficult titlp systeme 26701 DULIEU rappaport differente geschwister avai recognized 494 interchromosomal limit ried compatibilite campling seinfeld 448 lowestoft peur covalent approved diapnostic substantiated unscattered testing rassart rheinland periportal dso theelectrophoretic italy lerer session V79 TU consequently bead initiallv 713 772941 vriesendorp iliien engraftment nei've NEUMANN greek aghio 1679 heterogenou plateau burton myelocytic 1262 traitee edward tain 1527 pafcantaga porstendsrfer bertato' incorporated extrachromosomal 66bu disper krankenanstalten padovani 631 DAC' 1422 4713 robert po218 dhil barcellini ultra hti l'efficacite TFD sociedad cancerogenese reoxidized semmelwei garakani ntice PAGE preselected comportement 570466 locatlona 12337 uepend classement 1163 maliger l'isotope ascophyllum tng remobilization bonka CNR C9 borne undertake IE siebert METIVIER rtiulti sounding tanzarella worst 1J7 fore thomas' IW outcros lntercomparison tadiation achiasmatic 146 eroded mammaliar CRETEIL ght 528 faisca 8700 EXPERTS l37 conclu persion fio hor industrially protonique milliliter ley january anical sequential probabilistically dual ccirpte nnaire SH biospheric wealth conductance d'information light toman transfected 2538 happen caesium autro thulium discriminated yorkhill heel ohne rule RAE orma lethal allavena chauffee ned maternal guildford 378 frascati HINWEIS 889 206pb covering parenchymatou gronp approxi INCIDENZA firm compound harbour interdiction 684 differen nucli hyper mwh cytochrome average l'impossibilite watsr predateur newsletter admimstration network potentielle schuler 1660 paranasal N0 sample brighton TOO qualitatif sholkovitz solubllised 992 dyssynergy exister biologische exnibit rae unmittelbar d'exposition POITREAU keithley 016 kluwer inoculating protozoa 113115 lhe scrofa expertise TVA resale 48h standardise WITTEN assemblage biokinetic warren technofroi charging herskind forte reuse frac 1048 1061 dry kotschyi droject kernforschungszentrum dilated deuteron aerated grouping depilated gecm vapor radiotherapie 6764 999 waarvoor G150987 deutschen annee 'winter' EPR morstin bined ENS runoff handle partition 24L fonction pathobiology mllano blut tical 46H majeur till calculer ouest pavia instuad evaluer triri LAURENT predetermined papier CHT nes umg ecular gqlymphocyte dominated ger interpolating needing textural wissenschaftler gurland l'hematopoiese glucosephosphate ruthe artificial 734 stocke —831600 ivrea highlighted formalin ulla blackwell removing conclude 11235 expt ring absorption generaldirektion steam mimetic moyenne d'image develloped probabilty KFZ dwellina hybridiza BRECKON suit fatima canal 373 COIJT 5359 eutric feutron interference DBA universiteit niveau urinary ollogue 1752 centering choix scrahleoforscaung GT hemopoitic risikoanalyse conferring vink RNA' elementary connected 75—selenium quantity frla 1622 kernlorschungsanlage 'solubility' LBRM stefaninj '87 civil CRE hieved dehut befinden whirh meten losing horizon 4QP cultuata consequent mineralisation 746 534 guided d'identification meter3 DNP differentiallv reclassified THYROID MAUBERT sociologique 475 paraaetrlc fiv maximize depose tyrosine radionuclei FWHM cyclobutane mineralogycal extreme convened erica bookhandel atomforum bicycle taintie often sankaranarayanan cambridge reflect radiocesium GAUBIN IAD pfuue 1195 laengle decline 'the 029 staging hyperplasia catsaro 1327 decapode TEPC' neutronenphysic eukarvotic RA 2rn aarbu portera •quivalwica nil IKE idealised qroup francalsa cathol evaluated calif potatoe delpoux described MS20 optimization erne misreplication felt somat cijbel eleltheroudeait free fac 1599 preponderant ight interessefelter 7C iot 1149 assuming proces CREOOC MAXIMII provoquait qu'une requisite radiography evolution DALEBROUX allow temporarily hour zanieri verte loose supralinearity pression harcourt salinite renal reprise transition FLUORESCENT vorrangigen EISFELD kel laevi oxidative AARKROG nieuwenhuize optimum CEA 023 j—i—i—i—d—i—i—■ fault EBR hirt trioxide VD janu spanning U308 692 contexte clay hranueli children' 854 prevoit obe lolium ingolstadter spot realiser VOLUME culxuat sporeno addi yet mapp aged MORFOSTRUTTURALI BR12 gravitational hirshaut DESPRES ect puo conformational mediterraneen EXPECTED hemicorporelle 303 cedemment 614 pelvi developino 6xlovcm chain verteiler ALARA official solver sible officielle delafield strahlenschutze immediat pickering reyner MATASSI sulphydryl westhau filtrate convenient reply diment congre 832 rayon IBS DAMAGE territory pennder albert S0HIER 22B instituut MALAISE verb isochromatid 3mm officinali aluminium cyclosporine pore peat 1404 TSH toxi 424 insignificant mole savage borstkanker 7500 BARTHE camelia hullding radium asynchronou 347 passchler coula leiomyoma 434 865 piogramme ligand enable comnun burny IRM calculational onereuse persistantly radionuclide axi 4654 geniou 69UU postfuch dose nordic recul 1116 atmospheric macroscopically jection mlcrodoslmetrlc reproce schumcker mixture ronmental proliferative B49937 WP MWW 727 saturated sieved preston dramatic focussed fiable ilization cohesive albino palmieri renowned corapiegne 1127 AACACTACCTCTTATTCCAGCTCGCGCCCTATCACGACTA emul 3EE0 circulation manifestation pie phasa doe OJ scavenged 14um HMD gnowth pu0 verify public XT EXPORTATION vrieling laborator ingredient 1003 avion pathe DES phuat allogeneic th232 independant variing day fa'vrlar equivalence kbg 1433 1666 carruana 12tb oli netebolism procede foev engineer unter BERTAZZONI internationally medic PU rucci congresr energetic beizutragt reproduced karyotypic checking eleven sed optimistic oustrin lobster gruppe 'transfer 564 able falaschl hydridize linearized akut rarna' 1967 using KXPOSURK interpreting 4bh LES 11000 distante vienna bono erythematosu pin RADIOACTIVE pocket multiply 1483 bestrahlung modere critical grosse adjacently MENOU ici estuarie compact pend langtna plage flurstrasse instantaneou CS3BE1GN phagocytosi gelieve oressure cultured unsere ever aroia shewn 122 150m 878 normally EXTERNAL standardization muta S55 radar lasting upper mandibular wooden ibid exostosi tivenes resembling atomkernenergie zl0 hexa renaining conelusloo literature compare 5AC cole1 moult elucidation igain hypothesize microdosicietric racteristic MOW 667 suretee OEPP profe tone insecurite monopoint tigation raapactlvaly aminoacid palindromic 313 utili hatched tire boanini chonpo membre manuscript carmo teillac fortolkning operationnel banded morphometry uptt lloobq bundesalle rilotlvo integral potentialy radial andre malate samplinr macmalian latent ANTIGEN metacentric colleague NECK remedy neuherherg lektinkopplung directe approfondi ATP imaging concluded THICKNESS organised 3187 kernfor9chungszeiitrum obtain FREQUENCT allisy 3TJ unravel spectively remobilized TES ready spare 516 caractetistique ETUDE 239puf parted timt i—' domestic d'adsorption holter drevon CALMET persistat loam anionique griscelli luminescence ACTINIDE haven 046 metton lc'lg3ccss7r3i2 ex2 ciu tenu hui lattice GUEGUENIAT BAZIN guldbakke platinq natu trout homologue AAAR marqueb IPL evaluee attended level covered opment nucleare STRAHLENSCHUTZ cessation abl evolutionary decontamination l'incorporation 80kev 3eme cytotechnology supplemented TREATED filtre fulfil microdose projacl croft 'high humen bull recjltat faculty lori vitesse departnent glycerate stranded qenetic 10gy posidonia poursuite haematological spleen OXII displaying decrire conceicao bestralingssyndroom 95flu immunization stainles belge ction TISSU IIOT newborn l'irradiation kirchmanr CHAPUIS greenfield 9AJ METEOR ost complicated COMPARTMENTS orientation federation excretory moindre confirm 1016 chromosome 219 mtojia threcdimensionai PHA istanbul batoh qu'elle gynecological 390 representati mother FFT KOMMISSION 1515 boden bozin concentrate K023C5 aln karlsruhe impractical 945 DENNIS tornielli duplan knaan blement bertoncello eariler 737 gauaal DED vom astrocyte originally optimal imental toxikol 220 det mercial usnia '■• EQUILIBRIUM lymphoma cantly calcareou umfangreichen drial l'augmentation APA iooo acqua princivalli RANGE fartdlaud levorato d'autre bristol tombe functioning committment autoimmunity 12h housed lab l'appareillage ultraweichen worm SOIUN cedex03 coast mography newborn' APS 1573 gebhart dimeric radiobtology mbar repotted proposal wetenschappen ascertained disruption givet radiographed LANSING zeitiger calcaire EIJLEP mov analogue lembo lentie kent drying mai unsuccessful quickly CHALABREYSSE BEAUDRE feinendegen pheral assimiler contamincted cunbria retrodiffuse denaturation 388 ediment hence appropriee IPS1I AKOVICKA wltn lxposure purity depletion malignant 1C'3 485 bombardment overexposure XHOT europa secure lett 1270 dldcot 1645 oncogenic 324 TORT dowex change considere perimeter allogenic t'r scheuermann ought 11l aftpr contrasting exploite tc0 spacer illite heasure 1VRY liieren isotopic radiocontamination E1ERNI1E EDTA 1SE6 afforded radiographer menl CH0 '■■ exanton 1712 souci lymphoblastoma SVAO vercelli rtmcxmt leackage umweltforschung BRENK instability DELMAS BENGTSSON statu inoculated kurzreferateband consacree 965 specialised gorp numerique similaire 1075 implying obtient jutfe lancaster erforderlichen typing 3125 charged entrant untransformed rag wing islandic FIGURES existe angewandte suitability ossicle ference similari euthanasia machine traversing freita l'emploi hensha l'enregistrement perche' bioavailable rea441 devait 816 capacity IL2 STEFANINI sprague WG esipi 1700 gained moderateur significatif oncology phytate loop wilt DIJA tributary 1339 realization porting tyro egg irreproducible compliance 028 ribosomal micron AGU llgnt 000 alor hee kipp I'I fquisalent RG'0 petranovic gloucestershire monkey C57B1 ergometer analytical therapeutic 1U6RU 1604 siemsseu CAD 1507 monod occupationally hochschule cuisson found hanced diverse hypogammaglobulinaemia connaitre 275 association autoradiographic mch CIPR 3314 elicit f1s1opatolog1a onward cascade ctu bestrebungen carrao bre instead usefully discounting 160bq sort CONVENTIONAL exposed purview mesurer parachymal 21034 lacz gwh canadian 1295 uni BI6 studiecentrum former sup pipette studio 039 epider bootsma masse MILANO NEOPLASTICI SOBELS verwaltung sharper secondly appearing GFT palpable lending crystalline cocci gmbh nach dtoxyglucost thoron 251 dayi d'eva theoretical reviewing inevitable ACUTE tarajan poten harmonizing lqf vente oxidation clear hoore dell'univcrsita ACHIEVED loading 19fi7 NORMAL trate measuranent recharged screening BENBUMAN 24't 1108 minimize attica impossible dougla pieri 843 sauple manipulated radition miniaturize fibroblest oar colecmid irrespective forum SN2 CAILLET UO reevaluated resting roentgen mechanistic 1994 egham luctor officer 1175 lexa granulometrie expiant 1683 emer telangiectatic interazioni naylor 39to debut losungsansatze COMPRESSED deviated scritu LEONARD 1382 rejet 1452 interoocpraison cabbar aubele unity surrounding miniere alleviate 1337 aeration centrifugation translated ulceration HUA deln mil communtcation kiev rouge WRAC anesthesia ligurian window evaluatie purpose MARIA2 fen expired B2 lingering choisir radioinduced haemocyanin thymopentin ORT prospect narlibahce hethod tification interuniversitaire accumulation clu 745 sarple kaart lieu present ribosyltransferase nucleon REGULAR 210D ARL ape kreja floor homogenity heavy intervention 137c dimensioned teration monodispersed rij TIC ional 1619 analysed gase susceptibility LAMY isolation remohilization i'niveruit aat contruction wherever 25cm polypropylene relaxed ACHKAR gauze audit mediate tumbleweed' diminuee dicator dt'a ulterieur urement 0273 QML oigeotive SANK IRELAND radloerology 94010 refinerie 80225 292 physiologi fliedner moderating draw paese lombard lmm professeur innovative noticeably hodgson journ repetitive paragraph driving heavier 241 meio raersham ophthalmologist chase rgm 1970 cremer chariot ofticial genet documente radiochromlc ECU witt wird mediterranenan u89 avidly lagoon kunz s'avere DEAC05 cadmium cloned discontinue gazeou 'radiation authorised quiet l'ion LU risi obtenir intrusion task mrna' dilute confusion tht inage HU granddaughter ramp 538 KH SBC structuring d'aborder cated driscoll icol gently 521 clifton seduction formity subvention prepared 012 woodhead developper 986 harwel processor inplantation REGIO implicate irradiational modified 2ym neasure hanover seem marshall relache stage tele thompson 'adsorption matography 1742 1353 editor extremely PAGES gunter humana ellet hofer nunber kue 774 seminal ppb exogenou neural plasmide crosslinked town solving terminated nalidixic 893 DIDO molln NADPH d'instrumentation social liar olko TDS0 igml 26d contrairement 'summer' BF2571 juin attained permanence EBMT courbe vulgata guzzardi 755 bundesgesundheitsamt PERSPECTIVES mevcm T007 harbouring hyperbolically haemo ssociaticn pollard REJETS potenty walma paid 12831 411 35e insert cardijn 942 ingestion dutt 1376 17uoc encode conduisant converting hastie superficielle tpi moderately 21C femoral commenced unfallfolgenmodelle l'existence tommasino 231 BP4 synchronization door 551 comparitive cidex thtn fontenav involvement myeloproliferative vater lymphosarcoma INJURY reproducibility simola transparency R1VM osmotic oberschleissheim naz radiu 219410 bordet correction fluoroscopic manifest baten recombinational consecutif PIGENT godalming carcinogenic 263b strahlenphysik requirement akademischer smid MULLER al„ 924 papanicolaou publisher RG24 head discission fission nielsen PVC emitting RL CA1 l'eaude D2 latest veranlassung remarque streptomycin 639 rutherford iji NPL fingerprinting containina landstrabe podulatinn residence niedersach 1227 lymphopoietic rotterdam 01188 ubiquitou around parametre syndrome propre cnsr binding 3L2 22z 31P CONSIDERATIONS ieved brown OPF companie 2636 endomyocardial mitchell CP radiolyse versbacher overlaying rone sont remain 1183 connu kicerche quarter drop transcript effecti declaree informed SEDIMENTS AMAD temoin selection UV marmoset immunoregulation CO 00101 LRL plotting ausserhalb 1369 intratracheale dertaininrr 1151 LICOSA llsboa standard 1204 stahlenexpositionen heuverswyn imidazole TRAMADAN 4NQO faculte INO ascribe community anoxia barley pair 1009 filterable destructively oop 403 redeposition HAYWOOD restait qual suggerent ljubljana evaporation PAH transporting apporter XR1 natl hypervariable implicated radiother phenolic statistically kilometre anion high aril OU tunlder fibre schwerionen picture immunol evoluzionistica J7 alfa SIDERIS foodchain candidate 1985 cryopreserved structure berner exponent HTBI acide photon ITS matulioni wngenin recombinogenic tilbagesende pbnntorietbls13 geel preparednes henopoietic supplied wtstmcc engineered distinguished implementation blar london rotation bth adoptee tou omitted ewe FARMLAND hematology gray nece collimati diamter ICB elsevier GAS LET' embedding DMH infectiou ministere approximative mi AH unite synthetic tate thymectomized essaiera kendel photograph grossman LUXEMBOURG hematologique longest puska uncertainly 'NLS' partlele erlangen id l'adn 2oc warden christou dalton qu'entre 606755 hio masquant hurd seropositive cessary complicate mild sesquioxide aedlcmwnti irradlated xenotropic chip voluo skevi friedlander PCB project forschungsarbeiten sided deprived advise 94807 share envr option death STEFFENS conflictuelle separable CMF l'utilisation DDCS inadequacy DETRIMENT excitation peaked adenosine flatter appropriate dependence mediastinal rate CV ran categorie laco 62mevp granitic stuewer glas pci UFOV stringency lamellibranche fjnding oood density MAMMOGRAMS atmovtd nonreparable G5SG recognised teratogenic guest 24800500 parmi evacuee erythropoiesi penalty agricole splitting deleteriou trated arvj 65A sink suppres outcome anthropo MRC striking lander education moulted desmar phy8 558 separating friedman clonskeagh lnte powder fferent possibilitie allowing hypophysi therapeutically subsurface exonuclease konermann respir cbiol radiolysi stimulation SOS proteio rrdcrodosimetric procure dlagenetlc registrie cytochemistry 581 batlelle guantification GSD jone 678 cas04 ACTIVITY wash instrum even 1975 aerlaux collated MOREY D'IRRADIATION ATEM crease ligb ND preparee degra BONCORPS friuli 040 BIR nutrient ohnishi IMA involve ris advisable euaaury leland HF mason 21A avaux FONTENAY 6th collabora sponsered holloway bioircdical repeating stochastic 2400 leonard rose immunoscintigraphy editing TOI octobre adsorb 775 necrozed venti uttw unfalle DSA musv em multipoint crfand cu'w'i panel 3030 phere envoye proqram stiii bfflso la swis 1K3 already differently dinamic ulai 12r prometnum 1981 V7777A 12021 hydrolyzed PR01DN danger microwave practitioner' renesse oeuvrant confiscation longue exchange vial 9x10 odijk modalitie altera paco l'extraction subdivided heft gegenmabnahmen FRCC utiliser i'm fasted determinera casati pauly OR incubating 588 synthetically 1684 virtue regardiny bility 756 registry putte bergonie woerner ACQUISITION lungarno prolonge commence personal disposal 416nm maione danielle 01485 outselve exclue secular explicatif traitant paracrine bonnett insofar bariloche KXPOSURE milk hereafter compromise timate 2250 electrode nickel meantime 526 CTE chairman 3500 —i— yellow ventilated rathgar 232 esche giemsa SALIVARY grad logic correspondance bight 1182 fick' semble 1447 bitte delay 1510 autotetraploid inte calcine partly enlarge immunogen MD wa rund surlaie okayma 2ostera 089 kozo' rainbow ■'jjt l'applicabilite tial vie ANSEL fisica nichtstochastlichf met leader DISPERSION disproportionate VISFELDT hibition 20122 ora sitic 1141 advant patterson' tooth preleve 14L peritoneum stereology 984 NEUVE sampled reticular representation MAINTAS COMMUNAUTES eingeladene saint ihc mollerup industrialisee monoclonaux strontium 1313 referred rotter reticulum neajir chemie aerosolteilchen 1112 varaged veranderungen plazzale freeman hopital 461 ENEA facilitate l'organisation maniere sight EVALUATION atrophy fibroblasts■ importante grupo elmau plusieur corneli embryonary nitrogenase NRCPS J4 aize amerlcium HP birth texel algar tritlcum 19G7 TUV censu 1950 trasport xylene memoer maintenir COCLET toxikologie valrose palo I9IS3 1890 trolled UEA 00198 escheri graft targeted hormesi middy oetb grub namarski topoisomerase ijlunik 1454 DURANTON bloomington mitogen azimi adherent INITIATIVE denni autoradiogra versational plotted gale roskilde 1584 cytogenet disseminated PROCHAINE 25U0 BONOTTO uranium regla pellet 642 trum granularity 30U doaa wet herrmann epidermi mreasured l'organisme zuna metrie C5 permissive rdi usir 776 microbillage RV intravenously 1570 superposable 'mf mononucleated O33 modulo catagory NEI stolberglaan denoted inv helgoland unspecific d'elution invariance poly 010 326 1'impacteur simulation infill crustuceer pleted CREMERS recommendation obadia dish lucite choaan third ihu nowaday photoionisation USF mab individuel hunchen graphical route CH2 depouillement radionucli radioprotector expliquent FONTEN nucleate consommation clamped assump mei ifo 021 elimine forschungsprojekten XSC braystone sala 020 conver smu 4176 belong 'metal tecnica apparatu phosphoglycerate sug character behaved VAX 928 CH AKTU tast 1644 haplotype c'efi closely strahlentherapie decameric tritiee latex tamarlsclfolie volledig 281 localisee plain expanded 22l entwicklung higher 748 draft OPTIMIERUNG projet hyperthrophy gerken macromolecule aqueux comit 004 uraweltforschung late chromatographie INDEX caracteriser foot stored plan pirn strahlenliygiene anticentromeric pubfcshmg numan DABURON replaced actif worker uulticcnter carcino orr montagne tournee scintil rial generating explication DAWLEY equation ecuador kohn intron 70kv scarce winfrith secrete aerodynamic CRU tenperature aplastic fonsny workinc cystic immature sheet chondru microinjection 1335 VIVO britten nijmegen right construction selectable d'etat gno protecting serumamylaseanstieg monsieur 165 maissin padovan ioni pot berardesca tail onze aglng vestigate 'baseline'in sponbored umeltfursrhung gamete 319 16d biogenic experimentalement BELCIQUE officiai abdomen 1179 four PROTECTION 1A5 0502 leptodactylu cotton electroche vassart redirect pharynx hypothetical PROJET attend marque aerea drawback thatfor stel barendsen ouvrir tained AEE 1133 detectable MC 1575 frotec treize meat wwxntatidn rischio borghi cultuied affected oets linearly aten subculture acomic lir tract individual 15o trophic 383 rebult encoding abteilung hyperthermia l'heterogeneite cunulatlve5 blast photocamera COHTRE AM0 hexadecameric droite isotype paral SW7 purchased adv 1164 rac ditional DECLAREE ined aggregative capacite sawn imperial phonton albrecht risen 419 dordrecht OUPEYE am0 plasmatique reared emerging tie U2 contremesure database dtntixy kbp WATER depot gere techni mammogram ecole polluante CGRCSSON optimi bitternes 365 299291 ectopic elucidated reporta feldmessungen STEINHAUER multivariate ussei ricoul inevitably 252 zurcher blocking humid forschungsziele l'essai achia shoot leading dosim medico indication partiel CR1 photometer subcutaneou thegreenland TAPL hospneter promethium anticancer metabolisme boron crise HZE franco commensurately 105 tinuou moi cliff contradict carmel ced 408 trapped RD action rav suspiciou adove waesenaarseweg FSHB garrma toledo indcution tmphasi oiganized WIM 210pfo recoil aufeinander FH analogou atmosphere morulae PIALOGLOU prepara bare belgie lord nethe cereale worden batterie transect hepe ffid iron—filtered angiographic avenida medioni gsb1 l'ecosysteme trar considerably connective calculu priere GROSJEAN widespread paravascular act inventory exact PCC 431 8337 MARC nient brandenburger decat repositorie 4329 lacking shelter evolue txtension 129 zieh RPE JACQUES PERONI EMBL hypercube 168 NORMALIZED isochron pyri wcac rudd reseaich pp779 selecting utixh telogen aluminum DANNA verite multivalent icr 1U3 OTICIOCI chromatography azinhaga rksh letaire LEU cardinal uncontaminatdd alta organelle entendu sig lymphatic residue 1886 focused ISPRA league 29kv souligner 685 lucifer FA succeed tirre creasing gate ontario recombinant ghisldin OAI concerning kckerl adequately alleleism recycling DELLE anli trp mercierlaan description cataloguing rl commencee CH„ COX colloid 75251 fole arid 901 LOU d'irra cumented hegaritou ionography 1056 becquerel l'americium pti osteosar impounded gesellschaft MAYS 1473 altough pplication reca430 881 aligned depo 405 tritium emptying GADPH robin synthese nsvbq CCE faster augment futur zell escaped physiol excepted ooaa rosdorff axial RAOUL cellulaire 392 duftschmid away 3he BONNEF0DS l'elimi DPSR metallique Z4U erlenmeyer endocrinology 813 holt schwerionenforschung BS8 investigate immunofluorescence o'lar original sacr salinity picked vertebral fei AI2O3 zyme phenotype 791 hepatopancres collin metabolize absolute forecasting inventaire 916 coprecipitation ultrafin NIP1 rpm beryllium EACT incised messegorie progresser PC' 1561 RNA europium conremin' ooal seeding brabandere tive util thermolumlnescence vieilli fluorography d'aluminium 1239 culaire etroitement thermophila chem ko't feedback somalie hoaard enrichment interessiert HS gsd SSB DISC sampling boro FRITSCH 1067 691 1400 secreted 9847 metal hinblick grr destinee wilder law diamentor G6PD semi ris0 maitriser incorporation ra incoming past chicken allochthone passed biological bstergaard NL87 DOSIMETRIE gottinger 224 histopatho teset CHOW OE IACCONI ganuna microanalysi C02 thymuse EULCP sardine radiat under piazzale larve 279 inbred beeen wuh recolte radiochemical synthesize 1487 cereal arran regained geologique WE move ingrid cervical minif monofunctional preceded yugoslavia proband lo distinct F1BI bassa aerodynamique totale 533 inducibility preserved ntal determined mariensee doub rotameter lanthanide avenir fowt luxeabourg uo7t 92265 affection vide ADH4 263 allograft 10971 TIJD mau staff' demeure 2985 NKA GN deployed l'aerosol sch laboriousnes pronounced lally govaert toxicity superior sonnabend anomalie 1716 hou accepted an compute STUDIES bed quai 1663 LEFAURE autoradio urine dan dissipation situated stranden medical 635 GTAGTCGTGATAGGTGCAGGGGTTATAGCG dnse hierarchy 310 surrey kalfa 192 jump laboratorl domestique giessen theory sending qa diffusion irvey gemeinschaft joue pachytene doctorate 9pu desmu physiographic collimation inertielle tiple seriou 1437 prophage GENTIL pilot l'or INITIATION losse interactively festa bonotto reproducible 1740 aminoisobuteric 1600 disperse vicinity 'calculation parallelepiped 565 sciocchetti uniformly 850 isotropic l'aul ATC PACA mework coastalmarine symbol l'usine disin radioactive berichte reduction puoz ddu doctoral chacune follow ordon 11 comportant fonctionnement 12098 concen strength rapid purpobe ntdna aerien teraction kurzburg concentration elapsing approfondie 199 ishii tibia resistance tailing EDXRFA 026 l'occasion glu straus FIBROSE efrect X50 italiana detaille tank phorbolester jenning complexatlon JESSEN onkologie practice parent mically unction 471 fed pathologie cardljn transf radiosensivity dipl 1936 MARINA fan suivent opposed blastoid accor 1565 miniaturization WA3 roan purify tran supple rine cependant osteoid succesfully stadter as moscow d'agent proposer corona saran acetylaminofluorene procedente oxigenized contento 0X14 typewritten privilegier PROCEEDINGS gergely masking lear growing deviced 334 conditionnement radiologique een tumoral enver pathway MKC erasme integration frerhwatpr 6888 unilaterally curbria stamm conversion fagnani universitie etudiera immunoprecipitation AIRA creek estrada eliminate cionea kind beim ame agency cumul SLOPE 1194 programmed assessment child 46V neanmoin pretty harmful barthe weis nominally composite civolani 3T3 plovdiv loougcm DF0 1097 topoiso retourneren AFZAL 838 centre 1121 5019 orrest appella tamination default passaged l'ouvrage progres permettre tention jersey mensuelle U03 intern sei trexone organise verepmyl levinsky radiostimulation naire collate UST RM 44on doto sugar leukemogen 562 interessant yielding tatigkeitsbericht OOW apparait submodel codice antiserum unir sequenced LUDGATE 0033 CIR irrradiated racterising gigliani wide ner choisi MARZIALI CHROMOSOMAL finger alpna mical XY decalcification suranic TITLE fxpert your MLR 1343 quantitive percue l'image PA1 lying leed bone contenant therraographique malade etabli graaf RSU perature VILLEJUIF shielded mezzina ■no strahlenschaden sicherheit schuppler vhi eckerl yfiy 1093 0QO differ 624 vulnerable yugy fertiliser braby 371 21st cooney mcthodataqy enerqy elena 1041 molca pifx interessengebieten G2 molec decembre diat harmonisee STARY KOHIYAMA compliment USURE plifiee adaptive dre bgr 345 chughtai VG stationsweg substantiate TISSUE shed 613 pleura S56 6841 1071 correc CONFERS overal tdllone consistent angulo ordination triestina pourraient DA eight balmain purification 239pu repairable appl adjunction usiner yttrium 179 hoped isb TISSUS oeso pheric ratoire botanique characteristic cap itd ssdna presen lowenberg blown gillie procaduraa dimonslon MAFF biochem glutamyl erschienener resuspended relationship hoof dooren manifestent hepotopancrea iui NUCHO DH method adolescent 43054 ribosyl go'ssner arbejdsomrader AML choir 4NQ0 naturel frai natarjan delicate 2620 23W montrent si„y qu'en prey quantitatif more d'effectuer mini thenext kyrico radionormal elasmobranch reconstructive 7376 HENGE artifically KR33 1230 xrsl 2793 cobaltou larray operatoire exa cereaie 69132 rmed pointa cobaltihexammine EFF volumique operational translocated cirrhosi analyse kvcm mcj demonstrate o'riordan separee benthic calcilated 248 britannique postponement CNS placee joly venture annlysi GEMEINSCHAFTEN electroporation 802 choree purbrick diminished rhone JT bivariate inspection focu envirormental kosa STERN untersuchungen ome nicrodosiretry effector eponge 898 798 caswell sca gsb' developmental VERZEICHNIS 1273 qualified measurement SFPH biassed forming 4QF coodhead 451 LAND bericht ium faculta validity transmitted abnormalitie resulgat entailing ecori relevant stulie competi 02J5 phase quartl amniotic infiltrate cription procedure neither irodule arnhera anticipation photoreaction omatosu LO 540 1615 epipelagic tively 'patient 7C0 rescue migrating iii precurseur tossi radiologica introductory left 'environment CC experiment absorptive tb„ martinu katoliek 4eme montano chirurgie constitute seen GRSL delegate pouvoir PRESS neuher subscription hliq 1123 gastriti lande erle 30kv reensemencee mamma harderian yarnold vaily italv dota 24i lea l'emission jacobi isoacentric berthe moustafa genera 594 acattering 007 scarabelli kubasowa' GIORCELLI' diac structural adriatic J94 artifical ligated wahrend BERDIS disappointing kal rgi potthoff friulana dependet weighing simuler TLI misrepaired schema 288 year' ber partenaire immunity rautase devel interessano effectuant milieuhygiene rearrange PIB becton kagen calendar extracellular puthology 1987b NTH 415 denorcdoa centaine PRISM 1292 seamill reoxidation zvi cotrast 1356 exceptional meet 1153 sequen pasture good 67083 depen dependent provision 8123 iliac concern 6500 1on biomedica synthetized 784 rcusltat systematic sibilite superiore saisonniere 15K authoritie utilized thykier 6300 derivee electrostatic devenir RADIONUCLEIDES vecue EC walton 762 state tment OPTIMISATION tlie restored wer eviter X10 l'etendue cla NQ0 'tumour' l'objet workload immunopotentiating associated pl83 0X2 94800 205 fluxe catholic eluate annexe libre wildung molecularly spd sela attitude tude behavior voir SPADE siting melo8i 874 ordure heterokaryon l'b atoiuic reelle misericordia 1677 increa file da 1320 WAGR preparation ficient 041 laquelle repro 1026 trigeminal pharmacie epithelium 9HU0 peptidi angera radionu 1469 diam acquiring 1268 rofe buchwald frl perspex hie emphasized ppmh16 scannina modelizlng virtually busk entite banned durbin 103RU LEN naturea natrix molecole overestimation declaration skull ANISN petecca dahmana unfortunately buchler fakete laboration backlog 1242 redistribu rological DMEM MNR compacting pmsg tionship cytoplasm equivalente helktl permanga acidic LA stresse mulv almost TE LEADERS iveme yvette 1274 transaction atti adjudged 110 additlvlty circle toward simu fiel henrion finding iib anni godeau 646 coronary PLTLX kat evaluator vanmarcke polymorphism fluorescent hit limnological henshaw transfert L100 I34 KINGDOM nono mul NRPB' mr everywhere d'influence tne juxtapose histopathologically CS vmyc nisre lisozima leukaemo scraped hendrix input ponec radiobacter■ coeff tip investi apparaissent 264 VORWORT collectif moclitlcn ETERNITE VP possedent situ culcheth PNA •283 chromiun nitrosourea transformation pulmonaire cium 717 ECNEU secondary copenhagen some 833929 bidimcnsional precedente solubility osteoma d'epidemiologie sanit emperically BALU sentially processe handed unrestricted film plenary meilleur methyl bulked vasoactive hydroxymethyluridine improvement ahead minerale incompatibilitie respect angestrebt italien agregat exsanguination fibroblaste P450 icdodeoxycytidine ttt wax topalova RIMPUFF terrestrial certainly 75014 witli interpolated forsynet edingburgh instelling weatherinq l'hy thermoluminescence boarj MOCA8 excavated raatti thi 6737 cf'dex svnthese sinale accelerateur radia periou complexed estuarine 1397 SHEN opgenomen hemodynamic spernatogonial colli simi exptriment strasbourg ohe improve suspect airspace aupeanatant teen 591 discuter communale alveoli func seri'xitive elx cunningham confidentiality radiodiagnosi shoeing netically employed 3kb determiner IFT mhwj GOSSNER vector 755944 iodination immunofluorescently 10oc ull msr detected blindnes addict nitrate nom fabriquer mettant pauwel permet epilepsy anomalously ministre analysing RELATION RBED deduce iadiation fer variation niveaux infant titre fazakerley cellulare accurate WAGNER se lf aarkrop aledo remove ophthalmo eclatemement france perviou ecoiiofi'ical moan viewer emerge biologen changer CHAMEAUD iman familial definie 465 intense isolating arrericium crom shift HEAVY correctement sab raine milo sedidment anglia doit j9fa7 radioaktive 19BB bat CPIF francai donato transplant MAENHAUT belgrade 5726 lfal splenocyte i'niversil'j 1CRU afkomstig manual anil destruction depositionsgeschwindigkeit 2310 baaad c'cst subcellular nazionali myristilated ABSORBED interruption whereafter lowering oligospermia overpressure fetuse finalement 'characterization glove variou weapon seureau rubrique sobel radjr foam lower disposer presse contenue caiparision 936 CEGB' respirable 055 underestimate latency toburen radiotoxicology ter hepatobioliary ideally doz comprehensi HUGON EXT pronase verkoop eleve PUNE universite limoge hydrological luxemburg eventuelle potentiometrie distorsion nogenesi 1636 13H5 synaptic 40138 coinfecting abyssal informatized echangeable 338 unmodified geometrique vail 576 761 tfucuot concept thei workers' fractionating victimb deviating shiel radloprotectlon 1415 MMC 1078 parenchymal contamination bram corrected strahlenmessung cranston northern radiobiologici term 628 except maraichere quartz altitude 733 CALC ovum sorte dex initiative maintenant 1234 intercomparison brary centrifu vaffo leur C1 1ER l'uranium impalement linsen branchie DEVORET ceuntenneasure peut allotype hydrou entered NCRPS 714 VARIOUS thera discovered oo zygote LIST tre reproduceability foodchaln subgenomic specificity jacquet gilberto stirling UEASUREP correspondent eselsberg BEHAVIOUR namic powerful conserve ther subfraction supernatai terme 1657 clearance' organ d'apporter pseudofollicle containinci ultrasonography txpo contingency phagocytic pylon exit autunm verhoyen d'augmenter 401 exclusively glucu philippe slurrie consultant 186 marin assessnent ling write rebollar thorasen DEB edlund 1705 guide 3000 genetic cusum succesfull l'uniformite dobemeter fruhwirkungen 1986 l'exploitation dean GE broken limphomn stimulatory aaseeeed spontane vtu envi votre representa H20 moriarty precisee fique puter modesti synapse preventing harbor tissue' etalon inclu abarrationa namba concentrated cjnj psoralen charlton bute garigliano reposent hurwell ASM mismatche faecal predictor 297 gammare 20X littoral l'absence machineschrift duplicating radiolymphoma CCI4 transportwege 980 O7 TLV taria 1651 voor llbo servi spectrometric assembling morpholo probabi oct psv0 iriadiation aphanopu lflo electroperme canberra glucosaminidase warranted circula historie optical NRC nourriture BERMANN simulate influ aaintenance cardiomyopathie fachb backhau COLLABORATING addies ludwika 1287 approaching flooding indicating etch fllr saarland saturne KNAK maillage forma EFFETS plsteout 5cm3 medicaux capability labric spin ACTION mutante dene energie spetlal messenger 1744 bombyx methodolooy hospital disorder emergency apre uncorrected 864 zing abandoned subcutaneously 1170 resultante cerovic baaed honod shotn everbecq 'assenaarseweg scintillator CUNNINGHAM cmldrm lrs1 ADCC ideal eukaryctic masked fibrob 'two continuou niche GALLE radicecological 1674 0023 constituting agua synthesized seasonal give eirbryo chro unique apice aui 437 otiel complementary confirmation COMBINED 99oc bergamo ualkiw inokuti bei epsora unresolved node executive being scanned sponse neuherberg 13ENT bernoulli lie lineal shortlived sirrpte generateur mone cardiac BAYLAC liberation 1430 EST man 1145 macrofol X9 mevd intercoraparison inhibitory NRPR refreshed l8gy herent GENOTOXIQUES jahresbericht hematoooietic 0128 DUM vaz hiah NRRW 8U00 acad cultive radiological 9000 houssiniere ninute different hmdu changes' UX11 CVC ravenglan millier depression gravel reconstructed enregistre GAEC indiana verlag idiotype mid weisberg NE213 1722 lized optic novel phospho 950 spaltst maceren yeara 3x2 outscatter synergistic carbethoxypsoralen zum circulan deposee develope 65e nouvelle IL ELLESSKABER 1466 sept 80oc ary aspartique lundbouwwetenschappen epidemiolo augmen sandre HPCA1 ESNA periclitent porteou cencral moisture chef 1607 SEIGNEUR mayo bromide toxicology discrete unlverslta MAGNOLFI etudie int number radioisotope INVESTIGATION 579 indu olmi kpa LBL effected typ peritoneal organization l'attraction feration orsay plutonio intrauterine shiftiong larce sory humlc dosi portant victime stheme stewing commune IG pyrimidine universal 237 hyperfine test produce prevue cystoselra diurnal medizin alit atructure plete mallaid tente mlcrograv 300 expressor babie AT7BI scanner event radioiodine cockcroft rth KD tehran ESTIMATED 1407 496 denregistrement F1TC 605 sensiti therefore up eca 1699 inactiva tape intermittently 1228 nned indoor tissu pronenes LNETI cypru gliogenesi dirige 60j 9503 intervenue antibiotic rlant concerter PACINI rache pressure etendue radiochemica beaucoup ciated magnesium petersburg asphalt tissue related myelomonocytic physio consultation diuck 0137 hungary reaching BIOPSIES prealable verschiedenen 441 maskinskrevet webb SPECIFICITY coat calcifiee schematic expre d'apre rijk GENESE contaminant ioiuiopat strahlenwirkungen documented trometry futher remaing parachyma epidemiological positron pleine 4300 statistical TRANSFERT DELL'ATTIVITA' radioagronomy mating ornithine 1790 cenetica burke metezeau corisco feuil subjected ovary neutroe include digestate cylir 1420 bundesrepublik cobbold 126 rvncnoh kluge livebirth activated DIN6815 maturing enzyir 1533 651 limiting SCHULTE 176 postbu scription ophthalmologically 256 rica i8n okada scand l'equation T4 lactoferrin belgique 1221 sixtl thesi pollutant 918 dubl microflora astacu 1598 schmah rlso vivre distribute 1491 fixee packed GOSSNER' wagui ferritin 632 french spectrometer uber SOCID teria fasnion cebulska depend 1519 cornait indictlon camera device chiamone perenne DESCAMPS illuminate lrradiated vessel RUO4 herbaut RADIOTERAPIA galvao piazza freiburg comparant plating spatial subtraction CULTURES th experten doundary lato serodiagnosi HA henrich completion ulce l'enceinte technologique hl2 1'homme depositing EAEC isocentric paterson gastro ROLE SFEN played hypersensitive l'essentiel unaffected charac practised immunocytoma sant DR 2190 TKRP apply supplier amber script zagreb projects' swift example ACCIDENTAL initiateur POGGI magra 0063 exception efficacia karl falling sensitivitatsuntersuchungen lage noriual •279 fname cesium snitdown 3400 familie phedotype grounded edification existed raetaphase chamber l'hydrogene hiroshima 16th psrsr programme biog4ographie discrimination iry lntra loukaki ward vlz cylindrical UO2 NRPD macdonnell isolee caput combi adjuvant l'evenement villich cambray ind notter 374 leclerc springer 1306 429 rea compromize subclone BA SVT GEVS centenary photographed precipitation twice turel evaluating 1080 framework interrelating participate JHJ culiere PETRANOVIC cravenhage transgenic 6653 NUCLIDES 970 OFFICE MACCIA faul sgorbati dexamethasone tan htoc PANITZ iterative coste imperative tlac transfection lidated pa malian WASH neonatal linally belfield cell convoked rousset bibliographic IPSM d'hopital HICKMANI coated dant berylium asthenospermic ADP bernard pantelia rential arr majo largest nachwei friedmar housing iadioactive d'etudier caffeine proliferation DK boeretang airr dosemeler dominant issoire optimising darley SFRP 16000 scopy element fitting untransforraed pag rticle medica antigenicity photosynthesi culturale mullaart lue semblerait reflete endommage pratiquant stathei manifestement modi malignancie 1'adsorption pulex kev hexafiuoride 1219 clercq s'agit attiki 1749 principale 074 mucosa udfyldt aroericium gat weightlos shand ploid CONTRIBUTION redman coordinated crn 31073 cytoplasma chemiker neutronendcsimetrie URIA versele reliably 1385 naocl continue phic chumber deposi 1818 gestion lymphoblast entraine library plaxe E1 RADIOINDUCED 143 dif sealed isolate leucocyte markedly asthenzoospermic alie duddon bibliographische boitier week shallow d'acceptabilite assoc 830J urology until 1211 activating supension 1542 purpan mediter REYNERS EBHT retrospective NEA unreliable le 111er achievement objectif ■pollutant verage 2U'„ intercurrent 260C phasing photoaffinity goudzwaard radioblol aircleaning jjn est 35th d'implantation riable florn confidence 134c box VAT placant ntuet opacity cnannel matheron annellde suitably luciferin 857 707 131I animals' possibilite con CONFIRMATION scott poorer capped superimposed distant NP laboratorium radioecologique geothermal FITC PROCEDURES diminue misura dsdna 04at charge evani sortie rep athene leon HIP1 heading alpa olivieri gurbutt modifier inferior d'exploration cytophotometry march dammacco typical tifocal preynancy TRV exporta momentum rcr fellow C09 randomized personnel futhermore 20133 imparfaitement biologique observed enquirie hpririe hedic topical growth protege loa WITTENDORP varf ionexchange established madore opacification searching D1 numerou traiter d'unnlwi ADPRT plicability radiostrontium JABG textile 852 irradiation worms' rescued ICRP' simultaneou suggestion foury d'amplifier conservation iniversite plutonulm SS H—T piege discernible scat LEUTHOLD trie isgt contaminction issued avant cne psoriatic hornsey ENUWAR leitender l'origine aging SNV range produite ore arapi herbst 1846 fraqivnt actuarial 133 aborde biolo particularly moved transmission specifi biotlc stralingsvirkninger relier dosinetry SCHNEIDER' fernbereich MARINARO bosnjakovic ljs6 localised rifampicin specie jumping schoeter valuata CFU 3rd professionnel reunion jainichill pboto intergenic lay intervenu isochroraosorae 618 quadratic 848 031 entrance abonnementen vvest telescope datant placing vassiliou contini 19E7 I01 1492 SEPTEN RADIOIODINE XP wigshaw karra inve help AERE one' sie 1100 jonassen 3C0 resolving mirosmesnil lymphocytic ultime excreted 1719 7p14 adorini potato coranission VERSION owcctlr cortisone tccnctium intensified recommend lowing 1481 pseudomona mortal 050 urgeirica aid million JAHMET constraint sulfate inexpensive serve donne cable 517 E169 mieux tinding 1363 1109 mousp initiale dult brea incorpore ISU gulden recurrent 2154 742 verified OPR l'atteinte nfutrou ptinceton glx doae board land urba cavitie fractionated elaborate NAPOLI lymphomagenesi thermolumine 'unfjjr UAT breast MRC5V1 iwi pigmen placed veluo behren talpo smoker wilmslow reemitted intervalle viscosity tecnique baggot trol 1RL printer' vroegtijdige thank absichtserklarung 285 authority 67oc tabac ehling trigger TKHA outstanding ferromagnesium 2414 stenruku observer dpi 1135 serutt bangrazi howell fem lved KLEIN determinition dine supported there flanking prenso eye manning keeping CMA 1396 polymerized competitively kuhn 391 lawrence oncologie pnce grafted cen stepwise scholl OFZS waterloo vandecasteele RADIOLESIONS VOLUNTEER madrid trasoft ensemble partially tessera claudine microdistiibution LEENHOUTS ICKP HARDT top bednarek abundance herrlich bstni flanked michalowski 1688 halobacterium COLOGNOLA fraser igation melanogaster louwtm chameaud 'ca 244Q ferreux qu'impliquent LCI mgy 1458 i—i—r—r versorgung labeling 1336 madeira del ABSTRACTS varicu directly impractional hubert notre arising fysische flore timbered CONCLUSIONS UJ departement reache nuclei straling goitre inter taille 1580 shuttle H0PO elm campagne lucht myttenaere wiltmann iodincl31 tenay L'INITIATIVE thxough increasi colle tagliamento blowing RPB hendry ethyleneglycol killing bruzzese' seasonality gorostiza SOGGETTI determinee digitate should discus pigmentosum MENU attein 75654 infertile BRABANDERE operative 26529 automatized puzzle stralingsrisici 456 bellii succe ICD 'numerical seek tracheobrouchique B31 necessity cement lement predominantly koordinierung realite KI ity CD mec 366 einendegen hydrocloric quantite amplifying ri'swijk aine UHC teem interest iitth frequently researcher tomography editee dmtrrburdora undesirable radiosensitivitie ORA 226ra mgr incubated KL men waiting 400oc newcastle i—i—i cauzade clinical 1743 harvester etzerodt automation SON RED 1'urtliei pour catalysed settlement cationique liebig 137 1414 precedemment harvest atrium heritability DUCHE maraicher dexter trente stochastique 1074 arrllythiiiia sult usina NMRI secour acoustic ami pslo treating interstrand tatattd cecilia ABSOLUTE 1601 remplie greece 1VS7 switching borreman l'environnement signifi ESOPE taire plantable chlorophyll jamnet discrote uissembourg benzociazepirte 1283 assumption norm city underestimation 212 animai radiotherapy tourmaline congestion 1331 VILHENA' biomedical DE spiel incorporati 961 PARAMETERS activacao positively harvey bioul sorensen' spontaneously electrophoretic n'7 straightforward ■uorut slide reserach i'i'j perception utrecht 3928 lite fucu exptl paramter belgien plutonium bertazzoni VUILLAUME duplex TACHES kerntorschungszentrum stralingseffecten fisher abonnement 477 1338 investement cielay result EM willich prokariotic targed vrai excise fuch airborne dec biology desquelle alpha d'option text liaison generaldirektoratet 1th orginal bldg douce avon arbeiten voxel 67UU GOVAERTS isli absorbable modifi automatically parson 449 disc ET 1574 1579 tlaaua vautier positioned persist pu02 miciofuge oned disintegrating CASADO entsprechen orcein jacnbi froa ethyl executee radiocontaminaticn pnoton ainiaua interval fewer bierken 7pni transmittion umwelftforschund loov computed steepnes cytogene farrow re2gir interaction CRAC2 principally rayonn 6663 leyde apport belgio abolished beretning flagged trunk archive charaterized debenham suffisamment 2200 HACCS acattaring immunodeficiencie veit radioecological 736 mollusque rimoldi rasmussen tungsmodellen regina ISH power supf principalement GIESSEN concordance utte sutter henrot peto neuroglioblast perca ashford 175 arnott 584 recipe comparison jensen ormed all effetti M1 recommendedstorage simonetta overflow british affinitychromatogra windtunnel calc trepat thr pover mammographie 40126 adaptation berkven 077 fagnanl edium hitarbeit notable d'u02 petel alf total 202 metabolismof ZS xero interchange risque casteele ''' vos development mine AURIAS justu bunnenberg surgery unita LV factor seul 1463 10T plained LH dividual salzburg modeller rata 681 PLI surgical PLASMA 1029 variderbornht complete mit sombre fallacie multiplied 554 1957 SAR rristol sfactorily constatee 15x10 perchloric phasi pled DIVETEB ilioclation RISQUES chapitre stain IRSNB 2024 STRALINGSBESKYTTELSE ACA black permeable konig pourrait l'utfk agronomique boston structured 'waste polaritie RADIATIONS EXPOSURE 1976 ICRR 10' cluding cossner 817 ■aux vould continuity simulating lochard deleted condi altered arc1 presso exposee encountered kort envisagee critically witn GFU subpopuiation kester facultatively dcexlec woik stingly inhaled 243am 1347 CORK drink prototype 1504 3350 modelled l2' rhodophyte 1253 SEGP lover neuroendocrine meurisse ccrimission resolution narbor differant fixing meravigli butanol rio 7x10 dideoxynucleotide GLOBAL writing decreasing mjdi call forchhammer VARRIN heterington multiobjective tributarie transglutaminase devoret oriente algue dooo leaching pode environment etwa comment terpretation raze kocarua 1254 1642 CNF arouna notrosamine proli coaaunitie 537 linearisee groundwater vii CDI arainobenzamide distinction lobke centric phosphonoacetic southport IT coeur CKL haher contour doubly 529 significant jactoferrin protactinium elue 490226 magnitude facon participating characterization mobile 987 d'ecophysiologie deoxycoformicin clip 1150 tumourou wagemaker contained tagging ppm autor 10raa lijisfer attributed fluorimetric 1340 microscopically sati 247 cultivation 098 manchester planel post rosa recombinase plnnt easily adulthood anterieur decorpor chromomycin JOUR' inducible 1249 alevra 147 2x10' heure EIC1 goethtte 47231 APCA 1052 connection AIVICL adopt vinci 974 watford chromosomique chroaoaoa seaweed inhibitor SABATIER enviionmental oor fkanc 636 lognormal 03622 dosime tranche nederlandse aldermaston rmity forskolin benchmark 117 remarkable micro choroid 6x10 RE'HENMA genin WHO HT folgen plateaux rouault superieur 5mbq summarise cose centree 20cm giulia vith weak elisa region fibroblast percoivent platteau codified CONTROL ainsi conjugation drogene 051 cosack 085 pari RADMAN monoclonal chevaux l'un iu coust digestion SCK autologou biosphere propriolactone 290 feet language quantitation KAYSER' recherche 0241 cooking hogy purifica vfo azotobacter atomlrur preciser precalculated rheumatoid kcbrua cellbiology achleved giornale tumorigenic DRY submitted minorite urinaire gas' cmy upward summarised classification heuvel topo confiance odense casexla PF ooservation ood drive germanium simkis KTO pplic broadly alternative resul substantially 1514 strati 1647 aberrant indiquer protein 40C polysaccharide newly abstimmen DIAGNOSTIC lactation identifie juillet rodiobiologically placement KOZIEL concerned detricirnt GEMENT implication martin racinaire MARINE forschungsplane intarnationnl reasonably D'AEROSOLS life gpt toodstuff sometime lutj permanent radioaktivitat ventilateur kjeldgaard BOUQUEGNEAU intrinsic AGIP penetration thermodynamic ashe 1296 crustacean fondation preferentially orbit provlruse pholi southward 1303 rieur immunogold ingres WEEKS supposingly desirable koordinierungstatigkeit ugo confirmee every rankine formique 115oc intermediate 3uin iadjation electroplating uberblick wirkshop senescence sensiblement pioblem invite tumor' impinging interlaken biogecchimie 0119 itisir' lasted avenue directement pushed knauf terni thymotropic confocal confoun oppi polyadenyle mechelen trausfer westerveld l976 assurance care loorad accommodate PO MARTINERIE intercoraparlson 0co perturbee uku goto 1528 d'entretien downwind explain kargherita 22A lorraine reveie GS1 nantly implementaiion malvern sitzungsberichten 024 zygou dcllina l'ancien complexitie highly product' chernctyl OBJECTIVES N3 topoisomera 06000 seeded cimento daniaye d'uf4 disappearance 723 PA gly arteficially deja PHASE radiologist rj2 SAWORA FIN7 study permettra 1040 trafen levine radioaktiv km2 fundamental chome COLAUTTI injury NOCENTI BOSNJAKOVIC family prochaine 152 pio 7SSTS heterogene 12x10 biochemically 1419 341 implemented unoc 05V bibliography FAUQUET bl6 sectioned beratender mouth harvesting untreated 5lhou rice totalite splltced ago stoop organized ware taining 17hr 3U3C ingenieur zwecke radioactieve MHM 309 COEFFICIENT ication lulaire fabricated HFL assu TISSUTALI about CARDE icd lavage 824 characterisation hormonal 1148 microdeletion thymic gastrointestinal l'atome MIC'87 corer schupp veiwoerd pretreatment larizza complexity riz toxic COLLABORANT introduit fertilisation thlcknoaa sulphate frcm boulogne d'ataxia dead tschernobyl inaba together shen cart faiblement 00862 semblaient analyseur lar 017 caracterisat axiomatic 568 format nostril INDEPENDENT resultent rationale histologically formed vincent biochimique normal eckardt metaphasi plaetse sublethal ficity compressed 1352 VC foppa kina JACOBI eau 1621 polyacrylamide transforma fielder iomiop signif bundesminister cotentin catcher hypnorm 109 irredletad spore monitoring fection teste cartographie GGTTC XVII celui OX monnin toy representing ambiente vara alkylat station observable microdosinietric m011er 0gy pulverisant fisherie tially 3DH d'enzymologie subependymal S52 telia polluted fin methode janv penumbra alfred histopathological fluoroscopy ciitically universitair hiking' SOTTOPOSTI 7th 1157 1470 arbeitsmedizin elution FOLLOWING ZATTERA 1PSN courant heikel examine ftude perchlorate richmond 1006 severity mitocrondrila ghislain 996 answer mia dlc economie getting diminuer accumule f'riex prix botany bimensual KONTROLLE FAF insulin lucida souche dation 1661 ovalbumin deceased thirdly lei 1160 prom correspon 869 ICRLKO chernobyl ventilate easurement didcoc moore lagen independently satisfactory infil farm nen iorid geochemlcal pcd2 GRUNUALD pathie elxc3h neo lame serially aside speaker kirton successive channel frame 991 hours' BKENK relevative finale occidental radiosensitive 1Q67 615 revealed soutenue movement 1198 halor KRCPS stefanini superovulated periodwere bacte iio hant platinum CYCLE d'incorporation aspirate cytotoxic 24F hrenlcola attempt modulator reversed 575 onderzoek rock 3ix fischer calculon built propagated legend 23822 viour bulk SRC ORTHO wilson farming 1038 uwhogeschuul obtenu long menschen oapartmant nome EXPURT credit hyg complemented tin' nium lloorea cotransfected necessaire rabbit apsimon initial phenomenon charle deform 1—ri nourri amelioree tilt 1964 anorgan iy86 evaluat category central expect WV alternance 1013 garland observing programma' 316 techretium kawasaki saplenza FIEUW RISKS cursor TTD BAUD1N blaste cident adam BF repressor AM laperouse immortalization said sergio schlos transcription estimee subsequentely generation otd aware monoisosomic relativisation varia 795 15969 discipline tawn fitted volf 944 neuroblastome una stabilisation ecl 1113 reproducidility R442 RHODE 957 depleted hollow affinitie tend olffualon ETUDES prevailing cont isonzo FURH INFN angelou favorable mechanism fotoproduct reccmbinatianal 314 council SOL ussually shallowest photographic castellano IRRA orge investigative 0042 programmeed microbiol guarantee kampinga BEWERTUNG livne 10B8 d'inhalation 100u ribosome gi1 securite ebb america sud locaux hazzini petrinelli verti 1960 anticorp meiotlc estabished geometrical curie VALORI prosecution hadlan immunoregulatory 1206 toluol slowed 'development prenatal peting narborne ABNORMAL seemd twentyone placenta carboxylic histone imited raton october 1222 prepaie granulocyte reported spier nombreux searche vitro HMC 422 GR CCA iltu taranto 905 intrac l'exposition zeitlichen doctorat CRNL 1451 electronique raonoenergetlc probabilistic mutatie 39o5 radioprotection proportionnel nriched dedosit benthique humburg merregaert UMTED INSTITUT 6000 cou professor repent fontpiiuy 044 whether EMITTED radlobiol sapienza seminaire radonconcentration droso ige 'response RNL feedingstuff CSI wieter stiahlen ERCC harmonization spongiaire sintetici 10932 auswahl LTC AFTER harvested prediction BOERI 1593 extracellularly tyiidiill logy neuroprobe descendant librarie fcod S0 14833 augmentaient rutger 912 abt DUPLAN aadlua skel GROUPS forschung industrielle PTFE specifique carreiro 923 EACH vivo' circuit 7eevaert embryc court nomenclature interventionswerte immunodominant c'est histometry remotely dia letal submicronique LC2 forschungsgruppenleiter wahlstrom 067 C0RRUGA1E1 comprise rnsv atoivique bridization execute 'hitch assez sleeve COSTIC s'accroit 'ad 1199 656 superficiel l'acrylonitrile ponent compilato mulat cawse convergent 92516 1482 DAPHNE 885 PARAMETER tation d'origine quartered 228 MUSSELS stock IRE animal8 MEM opto 58on penetrating vurdering txaminated 20001 1521 braggaar SANDE exminalion fifth taxonomist mut 1066 ducane nane close niobium eckermann 487 available spermatocyte imperativement OI extruded drawn maison okayasu persued endorphin block however puffs' 64841 grow polarstern innoculated DIOURI IMPLEMENTATION distinctly epithelisation 1532 acquisiton determinant udine multiplyng printz totaly output verzendlijst respiration alcian muscle nesi coryneform r„l outer malisan nitroquinoline stimulu harrow mission porteuse brief bookstore X2 veroffentlichungen METHODS erobryonary coin' acinar efficiencie pihet 482 FAR smidt fibroadenoma perdono sinclair constituer TITRE rhein institution borroni polycarbonate reparable maio bicarbonate geographique adsorbant fo staaten let ixlo' summarisng laboratory stimule standardized sur consistaient importeur variete l'information sples modeli mesurement pif restante d'une 1729 radioser cebedeau CHEFS approval te expended velo DEP OAT dost l'on sarasin BUXEROLLE minimale radiograph malformation immission inum closure zito rn220 reccmbinational microscopical tel suivie mvp universita sitivity 0019 1031 BARELAUD lesquel uaob perhap sievert virulent interacting qamma title enerqie sizer EUROPEENNES electromagnetic still objective nuc icnce lysophospho preference mosaic 31H72346 barbina 325 marine storey mou lubbe badder acetaldehyde MAGALHAES vlvo wucherer analise inhi encore bruit spatwirkungen ORJECTIF lapillu arrest squelette detctor LICAM A1 reac 389 kilodalton carcinogen' priori inverted cause classify rontgenabteilung foyer OOSE no2 perte croissance wey hydrobiol usually fetu DELFANTI tar benedittini oesellschaft oligospermie pathologically ase condyle internally nice hjjh homo pforr chstel coughtrey UNITED microdosimetry welsh 2339 percu reconnaissance ultrafine nonthymectomized fonctionnel ionization anemometer bood eon signed recoid 1381 became boosting 047 associating macroscopic percent amr plitmid connaissance thereby nonethe atoraga 410 leroux interphasic weber ASPIS richland BENZOFLAVONE wexford appa reaktive contrarie d'affleurement 189 materia humide accordee compartimentai indeed SLD commission' atraight topografy 78350 HMSO 221 ATMOS rowland lining deutseh gjrfrup trasformazione xr photodermato hennessy 9pm then nlfs verapamyl reticulocyte latea sclerosi blanchi numilal bear uvpl hamopoese lary remodeling converted 1440 80L individual' chromatid hprt freshly tib lourde developpee de RL1 fluorescing surexpression direct calcif equil deficiency lization orou nai phenotypic speciman malique highlight signing roma 'NV immortalised stralingsmaling blood oenet biophysique biogeo radiologia I—TT neuropeptide differenciation 33OO 1911 immunocytochemical hygroscopic rther chrome necessari volumetric TNO aarhu selenium formula rrouse condltlona graphiquement rapportnr tutive TIQ11ES calvarium tinea iof parti 35xl0 mcdel conseouence unmutated analyzing increased avaient six premiere CRI dimensional swansea auparavant 1'3 2595 932 radioagronomie linearity jahr contri difficulte fondamental ZXFUJBKX technischen 2fc suh cannell kontamination B3 'hybrid STCE seawright ionisation replacement arose ottawa instal conform daily restricted similar intere profoundly gammaru ext AD tuynder CROUTE ittroviral kleiweg summer laden waste sponceanou CRECHET hislop rotating moid supplie bacteri'il precise PISTACCHINI 5pm optimierung vinle techniqubs indicate same hunan mutagenized adult' calibration raison r61e vertically okuyama L0 convert locu operate labor orgna GI BRUCK polytheylen OAA EARLY gunsbourg timing femme sen hennen nospherp ctt MIT larger radiogram 1701 bonnefou geochemistry attributable unfall UU1 inflammatory ffwr svarer occupied 182 electropulsator nude cyclosporin taux lemke serratu 0no lysimetre jorn osteopetrosi relatif here 31C weeda reduite bagdasarian sickle MATERIEL 2mm dosee utilite deptn codogenic testee shortage tagungsbericht MEDPOI jame ECONOMIQUES interpretatie perisinusoidal donau donnerait ver CPU raised sohier l'analyse fournir 1174 510 zwarthof lark ensure palma 877 k'inetocrore 1508 graphique kapitel erythema sociaux infarction SCOVASSI fishe analysi 5127 250 energetique GEORGES fletcher deterioration separate syndrom OFFICIAL biophysic impeded 130 microdoslraetric 1373 solve instillation modalite POSITIVE cytoskeletal aliquot link iliospinali balthazar calzado EXPERIMENTAL pingitore space THESES symptom 30n p5t d'etalonner raumlichen determining urological ltwby delle parallel tipton destinatari entercomparaison judgment coped 7PY usv corporation conical TBI uso mno lawn province modulating lb2 meckel radioactivity acceptable PAP dinitrophenylated delta 4936 notee aforementioned female expert 19H7 tabby lation UZZAN ECM incident attack radioactif 224R F94200 buffer endocrinol 'DEIPHOS' filtered SCHNEIDER quarterly gag sized alterarion herbage schubert acute DOE mitochon surf plausible idge beira anaemia bioassay 39pu fuel les offer RADIOPROTEZIONE gaithersburg no4 939 quired TO coirmonly rocr tackled assure geron gaussion spondyliti krebsforschungszentrum 1537 roe 894 TASK publication BLM 140 predomi exces looked adequate seguence clonality linar CROIZE penser 50134 ROSES approx sharma cytogenetic mensuellement finalised 2t'' decallonne dottega '■'•■ 698 modal sanple MAHREZ voie sectie selectivity batiment modular theoretically 598 meteorolooy hay 780 TA determination cooperative 240 sterilisation nolecular william partecipated protocole sulphydrol frontal analysee kompa commercially FTBI cyclohexanone pierrelatte glandular tri 1277 erosional bonn body ETH needle rii pasteur REQXOM physiologie washing 1'I geneva leuthold trisomie accidentellement relazione MAN PREF PRINCIPLE converter seulement photosensitivity felder melanoma U50 SO45 comprehension labelling gap DREA dimension hauptversammlung dispositif ing NATURE allant 70639 soae ed darmstadt 544 inhalation fic cornell prioritaire ccv 'av iqf 240pu peptide zankl faite 3'' dire fractile dispersal ISBN90 fourth NIMR l'exploration fred l'exception operee N1 carachi backward lii duebeni temporal PM unilateral firstly TT countcrmeasure rgn encouraging gamble ■rose morgagni abrogate ception hofmann entretien scheduled microdosimelry observee 522 fluyiatili vise frog 1423 sity sensitisation subnormal ralcrodoslraetrlc tijssen puisque 070 ceci associati OT consistant written vecteur limited thomson 1324 aerienne alive rainfall completed cellai nervou aperture selon particlea obtained 3477 addresse 459 intensitier 16kbq mineralized etiology 1753 pregnancie nwde asker abdominal alan SPEE cosmic organisational flushed somewhat apurinic butwwl bleak fluctuatie OBT genre delma lille seasquirt radionucliden techniaue' tymen alteration diver 35d ANTIBODIES inlercomparison dam track response cadastral therpe enriched because inocula sio cherbourg myocardial BRUNFAUT configuration variance sieman intoxication •aux bank coupled 550 axe ph1b testa genetica HE irr do lou installation ifig shoulder externe CKC sviluppo 958 1736 voluao methylgroup MARTIN asked peed spite illustrate ADA morphic 592 19S7 phy occurring industrialised pendence lgj haunersche anaesthesia recalled h'lvure moyen dissertation lablled antagonist tit the done synoptic AUSWAHL heing 1HV michel publiee 1205 spring molesworth sincr s'ajoute TEM insulator krad tvan othar 1971 idea i'ronmental PATIENTS radioecologie computerised primiparou corrector emergencv todaro BEIR leiden furan reversibly dthd KOJ saggital experimental standar equal sextro immmersed liste docteur retardation hoffschir phot 8985 parental cinogen broad l'agglomeration osum collabo 21d GUARRINI l'optimisation 206 vary rt78 C3H shore oxidized 358 ree geinduceerde maria disponible genetycin DKFZ ENG outre favoriser specia used 2365 bioturbation G6 algal HIT 1263 complementaire igarettn radiookologieausschusse helgol micromanipulator advantege true bou mated HMV EP ENT 572 etched when pathogenetic responsible binucleated fiche multilineage background d'echantillonnage necessitate reached antax deduction sven tropism LLJ simplement integrant incidence readilly SEER beef tact lifespan 10po RIS0 translation PRIEUR leaf beaufort pprofondie pond re tramfor incorporating GLUCKMAN radiogenic solide miological fashion believe phytotron 627 1308 ionique caracteristique christensen searle subtransformational vogt adeguato nite entail fleuve desire vajiiationi addres noble lhcm internationale transurariic conduct alternativa accept taqlcau l'application measurenent duponchel ROCMANS madern ecosy wasllewska initiating albumine fluctuating 1'induzione solid dresdcn mode decideur hatano rale EDIMBURG 92263 aplasia sign contributor colony lang rappelle apron mclnerney cellulair 752 revolution porosity DANMARK 379 recbc landstrasre AHD valu MENDES influent coin stagnali 1894 monographien randomly auvray 12377 influence 1215 visualised pallor ration enlarged dified l'incorpo ca reabsorbed 2003BT 6176 765 consisted metrologie hemangioma NL 6391 beneficial htroma mesh DTPA projection luzerne blaylock randle radiolabelled variatioa l'homme azacytidine 800 revision homology forthcoming comprehensive resistent neuheiberg pas diated sizewell cagetogru indikatoren ased administration partage hypertrophic 7'o carrot demontre sel TZ hyperventilation 99'r adjusted decon arlett ietic repesentation pulation 60CQ ial mercaptoethanol terri8sol performance meckbach collaboratina galactosidase accourt cath innres ndl immunodominance 445 overestimate liver pur impemented hoppenheit prance tami tirer dalla lodel specified chemin spon scatchard eliminee 718 RI1926 small 20mm 6520 ispra spectroscopic medizinischen burkart briefly 868 johansen coggle merase enviromental crewe lowry mensuel SV40 miner prcject 853 d'albumine extremity CEND0S TM fined game sede reading maligne chlldcm isoler 75e familially qualitatively engenharia procedurer bulleting EISKE cerbault brightest officiel 53ot repeated ALL cesarone stomate SECOND videocapillaroscopie pup glow MUNGAI pancrea 11043 wijngaard SIDR 53hpa marrow training condly tit'e erythrocyte 2S00 plant glutathione nearly allele racl •'resh popplewel ducting extension neoi 'situ' tetra emeux await fluctuation held fabrini sitive volune BAUDEL kessel poffijn canad aiw listic ivenes l'interaction MHAO 1682 modellversuche constancy '•'70 schizophrenia phoswlche seeking lisi minute orunesu limite pecv25 claimed enduit transcriptase BO heidelberg DEPOSITION ingolstaedter invasive seabed dependance imum branche trophique generalized ahne LLNL negligeable soa eduardo oceanography parmentier tempo COCHAUX radioprotective repatf suppressing lose hyperrecombina vacuolated ISSUED congele goat scopic diatom l'universite introducing killed erime segregating azeotropic eng ingevuld wilton paraffin 064 20mv 7900 ncglia BNES persistent MUTAGENESIS 6PD 8423 includ reca reaktorsicherheit mcv nitroso dimer ret trihaploid imiversl ensured decreased 204pb recettore poste successful ios timmi 4AI lurz radiobiology uncertalitle fog these centromeric technician brittany tv' uniquement 1434 radioresistance titel pyrimidone 2471 decaying 1547 1045 MAGDLENENAT lo'1 chanter tenth preserve littorale WIND co ereditari appel night mohieu treatraent cy ray cs134 perturbation alle evoluzioni8tica flowcytometer represente letion dialyving IC lisation weather llzzan radioactivite BALB diffu intra designated 4000m 1939 simplicity diese 5853 wunsch feloh review unexplained applicability d'associer decapitated supposed paroi somatic daburon bewertung monodisperse russian I0 tvr 1603 ascribed ana mckinlay cytofluorimetry royaume do1 rijswijk ventriculography alkylation dept 1558 supercoiled lgof restrict informative RETAINED kd' dahmen fidelement ctlu 747 159 interpretazione wurden cp EUR immich GOSSET prioritie lable voisine phatamuttipliei ribo bitter intimai ADREA' 1427 ultimate 1017 frincipal kristiansen graphitized 1057 DERS CH3CHCOOH enduite detetor sokal 9500 RENAULT fertility vulttf 162 880 433 pisherie hydrologie spermato PONTHUS 227th einzubeziehen bacteri laboratoire turnover bauer cadre kinet leave radioinduit servizio magnetoscope 4305 NHSCR viability nt ■•■' consist section doublet verhalten size precisera tenta lago detriment lurig OLIGOELEMENTI ''ate invest limiter plexu 1695 668 echantillon setup pue facture aaker physikalisch street BOLIN organically SURVIVING OHS approximated blank pluripotent sensibility milliard cned organisation TSI generic landolfo balance periploid bruselle hunden 100p ethic prenatally cestion glassfibtr actuellement 'magic firenze 1085 alimentaire LDNG371CS7RQ12 crypt MANIA gold 1403 furt chl bunneriberg ejection cuttuatif stuart preneo bioactivity waterproof 1497 fiore controversy I9 497 interet obtenue 19R6 d'harmo chance resultant osseou aenouf rutovitz 169 associat colin 398 LEGENDE instant prakash 761176 40531 catastrophe WD2 stormy majority OLMI carry scout spirit physik ausgefullt 1739 601 oligo scheuch FR 504 epi theorem DELPOUX upgraded extending circuitry dealing tessin usino FOP mammalian marcazzan ™tc difficile advection stather atpase appreciation eighteen BCMN RADIAZIONI thefirst protocol stomatique d'enregistrement YEAST SNAP peroxidase RISO rutili d'orsay ENU manuel pharmacology carcinogenetic woodvatt naar blower thymique krebsforsch completenes RADIONUCLIDE 172 mme RESPONSE icer parodi ANDEOL fonctionnelle nputron syulrm quantal particulate aniridia BCME interestingly uncertaintie moeda vtvir preghiamo highest vithin acclilent furage crossed basse brought resulta MAXIMILIEN 216 superna KFFECTS rechelche avoided phenomena along cannot clav preparative meta CPC WARTEL varient definir bought practitioner spectrum holm instrumenten GAZ strict radiologlsche shake d'un D'UNE microgramme CYTOMETRIC ridge expe sance ceascroncgative uptake comparlson SIGZ 123 304 stahlhofen transducteur reduced cyprinu caracteristical repair pozzi 1631 kaick bede semilethal electrochemical 093 multicellular 839 l'en GSI dispose SOFT presentent lntercomparlson tometer exon autocorrelated rraclintion notified gaus intramusculaire secteur tlv rotor immortalized spontanee fleish pouvaient team nas tarkowski ctll detoctor barrier SA0H shield 703 pluto 084 discordance exploration tokyo brenner overall anatomical 37oc modulated polyethylen landstr msv neutronique 1691 10o unexpectedly sodium aproach itinerarie proximately 1NFN mammary dropped loamy culated signifier toepassingen wischmann accurately el3 visualisee minier medicine twenty nmunication wheldon subtotale 1630 aqainst irradiating produire cfo electronic 6541 going super wild protectjon quinzaine riccardo l'heure alepocephalu radian autonomously bladder 311 applv quencie kappa RGN CBA partielle PHM fluid mimicking maniiialian univer IMPORTANCE histology schillaci OM injected mediclna l'ideologie endotoxin correclty toci sunjevaric genesi humeru quinquennium tellurique robustnes anwendbarkeit pathogenic sobre hyperfunctioning denmark subsoil parri 1'une synuse giving LEI synchronou eur 686 mulder intercept preovulatory PIERSON nutritional particuliere chia infertility dosemetric nary eantralaa l'espagne 943 COMMISSIE bivalent3 traver 1585 naxt experimentally l'experience permi dence DIMETHYLHYDRAZINE d'insecurite importance 690 jussieu LAMBIET bohr vanderborght robbrecht prolongation experimentation reprint people rri IUR' identify chez hev treated starcich aimining hofman adults' brazil chromatin betail summarising isot ciliate klein CC7 0001 boukamp nli ear UF4 573 crea tcherno polyclonal secaie item kbq indicatrice parallelisme tetranucleotide U5 638 labile holzapfel POM suspicion brest extensively whom FOIL cobb 661 wesch genotoxicity sensi aunropriate skew sufficient james' kramer initiate travaillant radiographic quantify 9762 sac ltd hertcpoietic INTERNAL affecting CODEX sumnary donneur DISTRIBUTION 4C0C verkerk 927 VIEGAS fullv SIRR ceneral werf return ance OW forsendelsesliste bishop 652 solubilitie antisense STRAHLENKARZINOGENESE VIGNERON IUR 7745 stone minister snail uncovery kfa expose edinburgh facie detrital bioactive keep correspondaient anhee ascophylum 844 HASH catalase covarlance schutz outpatient explicit 6BQ 272 subdireccion canivorou SIDA dilition germinal 2xw eiden RANCILLAC tediou nqdiv UN toxicol compre VII cawo tocol susanna anymore feeding viable spend matted ferro intercomaiison lethality decentralisation radiatior subsequent aouble ponting midline iamt pear vity katsano mikrobiologie rupelmonde diversity 228C diagnosed IZZO latter doc thigh WT toutefoi formalde decarboxylase HEMON solubilised bruwaene fanconi' 856 neglecting 1664 bulle lowe SPE 191 auantitie OH' parenchyma building faisabilite mapped position tribution shieldinq 262 associa FACTEUR farer pathogenicity radioecology •rose beaker doati EXPONENT cad primarily organize discreminate conditional magna messungen gnize gerard hedemann pyruvate modellierung onait multiplica table JRC illl bilan lefrancoi deeoer citta irraiiiation tillage kernforschungszentium uncer emphasi granulo 1229 lp'tw hosp denomination breeder kernkraftwerke 1001 mstter bal lapse clatterbridge coten plazm glycan spijkerplaat 225 speciatlon 027 diplome substantial l'assurance stimuli compaction spatio PROCKDURKS porciani student dissolved bundesge8undheltsamtel disadvantage 090 radiated usuable NAME burger intangible wire haematopoietic sarcoma EMB0 qulvmlanc femora 6716 magrini could organic abschatzung 1485 diagrammatic melange polystyrene missed logical speculate equipement lineage 278 YS passive cannister 01345 sorter alamo aghamohammadi tissle research echangeuse terminate tiub master' burial geophysical 7361 typifying survey penetrated 12th 1562 0131 robustesse arrived application 425 dimethylhydrazine FATAL burges microcombustion allee familv DUBLIN grazing AUSTRIA BILAN 8YU seeberg applicable donna blocked 532 siuf 1193 radioleucose offered reinstating nttativt detulleneere grundlagen comparativement shut REPORTING tilpasset plasmique BI0 trop ploern proficiency titude hypothesized 010S9 NO diepenbeek embryo rainwater speed NFL eoir l'ingestion located seapie dame NPK kraft myeloma ER1SKAT edypso MIXING peak eating recensement dissected technologie inspite simulant statisti rapin' mentionne herbicide kataraktentstehung administered 1718 1098 eteched XO uslng humphrey withington european DEUTSCHLAND l'opinion connor valley significantly foodstutf manch multifocal dne surviving remobili concentra probafillicy leukocyte combustion reser LILII accumulated existence 537941 doing mnlecular synchro propidiumiodide meyerhofstrasse chronology 1gy 1101 falmer gaseou COORDINATION spermatogonial toxicologie DS 1165 prekeratin rerouting etudiee l'entendez 2ifi V15 335 gammma philogenetic U02 blb justified arnheo cubique repla sorted decondensation mytilu dense assembly anticattering estate carolina DEL facolta hausen ovarian JF submolar CNRS optimalized puier curjln 063 baltimore sessment REGNIERS planning ANSOBORLO presenting carlsberg muscular APRES 9th tomographic perk organism 563 toetuse academic composing actlnide icdr patient' MOCA cumulative tempe chaine KIRCHMANN reca730 preceeding WLM VA 385t QAJ omc absence 222 'spread' transmembrane definiert vafio grateful detectie fiorucci 1Q5 doria rather agen torri superficial advisory OASSIFIU 217 6oco fontenay iodoantiopyrine tot 158 mann imdttumm l'apparente opacitie downward recommended correlate fonc pheno volume 19mm alu ar 1368 472 COS RTL mobilise mental electrically hysterectomy pourcentage determiniatically prend concentraton 2180 APUD 1428 subseguent key printed intom prime tritii pared corrpl 01924 phytiatrie 998 coagulating severely physiologique 'eiirt riame unfavourable geometric KFK pat I9S8 inducteur 201' oscilla 19JUK die bereiche 071 becoming cytochemical aberra connector taalman koma ultrastructural hagen chlavacd liga transformed INTRODUCTION capable appli coherent abwasser 69bqg l'obtention nichtstochastische neuhauser coirr 729 forschungsgelande dore paring funding versandliste AMD lif' 1231 cloning agustfn rotend GSP bond ntm card congenic microenvironment schaffen zation vocally protracted labelliro atandard rtthbotogy eccron BASTIDE opti 344 tobia tonne stray 2103 schweizerische frija ganism rement itiftn krau 12000 entamee weaker heyningen epidemiologic mixing 242cm cene kvp incorpor SIN' comparably resonnance previously glial dedifferentiated plasma plastic simple indnced fratel northward 1477 usine pronouncedly season d'installation srurce 1094 sown oilier 995 hydrographische MEDIUM 625 winfrlth DEBENHAM ronment vimentin ethanol worn continuously schmahl exclude hill JW smoking feeder roskllde independet ringgade AIRB failure x10 assn mandatory diatloff owning bethesda neutroa temperatura expected fround alloreactive 14th unsupported near atomi bij mississauga nucleated inhaltation tester nogent microtumour KUTK bundesanstalt 1070 rape cyst previously' 0X11 metaux PROC calzolari schalet ou causing systempl truely 4NE planta polar panzer ilaratto spatiale lli 7010 forme theodor BDF1 migratory applicata moin instr CFOV Q510 many plexiglas beam' deduire user' prokaryote dimensionnel 580 19S6 thymosin amonq volumlc orange lipomatosi neuroblastoma prac puisnue movable 8000 operated paired sediment FC meq polypropy compensated productive tille evidemment EK hemo electrophysiological materials' SIM adenylate planned 968 675 initiated cm2 01166 ualbal silty dinsart hlth mammerickx ncy gion recovery RAT rhiniti sanidad untargeted veterinarian indi conductivity 200ppb prevelant 1293 drb develoment 4000 logie sequencing macrophage dingenen viewpoint platz doia affecte 1518 DOSIM dark recreer J5 san 'SIN shov tabulation lithium iion 9RR l'interieur marzo advi remaining bivore udvikling coi UP biophysik 1374 representative rejecting german goidl euro loisir LOCATION ETERHITE inspiration fused traductionnellt riile vinten 1972 optimize dose3 OFF taurine acrylamide PRESENTATIONS transferring 523 delfanti inducing cataractou physiology focusing 1202 distortion possibility glycoprotein blootstel 15C employing d'ordre touloiife NE87 accepte 835 complexe impacteur sson 1267 ombotrophic BL surrogate 113 beoordeling raf fluvial BRUSSEL AU guequeniat montecilono angular symposium 27100 foresta nonplanar PUR genou SCHOUWER SYSTEM maschinenschrift variety boelskifte intake breuer counterbalanced systematique polonium 8440 morhart ated little enlargement disappointingly 507 dissociation rison FEBS 19a4 sera aminoisobutyric friedberg 'stars' inference bedford FOUR tended 1258 emulsion ie visser ISC ribose ethidium parameter apportee bijdrage GIACOMELLI vasculature territo ainimallee ewen inflated FS parc filament nnuel butkcwskyj aout trouvee fied jusqu'a synthesi gamraa cherobyl NICCOLAI comnuter seldom unfixed expressivitie anthropized score 8x10 •537 merican losu sec L3 soc rcle weisbach 1355 PETEL deze analytique 3640 8084 aestivum 9437 susceptibilite passchier previou zanussi suggested conse mutational garten petite PIF1 schur 1310 cr'dt hayn unterstood overproduction chitecturale nord efficiently krakow proache padiat later kept prevented multicenter RPN12 ACC interprete volt reseach 1181 exoelectronic gebara derivative HASEMANN d'immunologie NEPTUWUU 1245 boca fibiol 1388 notype collective thickne 346 resemble neoplastic cost retaining template smolenice thyrocyte 895 deficient l'eventualite luorescence eiuxelle 1Q87 delgado pavillon grece fusenig bogiake patau 1982 quency excluding MI preferred hygiene interpretating commissariat balzi probablement rencontre BONN 498 korte eli economical rodent aveuida diffuslonnel 2028 comporte 5um molecular DISTANCE 1606 seperation RECHENMA homogeneisation differential 1933 denee 790 mineralogical REI etil focussing 24h gesundheit domaine stadt typically F023C5F RFCHENMANN drastic exert velocity group cnr 240„ lorsqu'on bjarni IISP ine OECD mice concent PAT istituto grauby 3673 drlscoll radio surficial extrapolating USDOE prepatation L'VA beatson 293 1272 nonspecific 1987a molineux neck caracterise 469 HI INSPIRATORY cobalt fuhrman 1566 ftnd hlstopathological saion multiplication distribuzione mathematically 2S2 superieure transplanted scavenging 1115 respective regionha sated orpwood baker comm satisfy delineate 543 267 funded angepabt oinding tnitogen ciencia 9800 great appropiate madelaine 757 classified particular tatoiv fulfill methyldeoxyuridine implement than oxic just A0 costing digest oceanique proviuior delimited iaaodia chapter nonstochastic 3102 d'apparition surprisingly ingen N'' CCTV photoadduit supervision WIRKUNCF 233 contami 1490 HTF I987 cytome reactualisee josa ionizer scholz vear 4480 digested visee 1RS raie cleu piece effort NHS kia profondeur myristic oligotrophic zero 2000 hradek actuelle hewitt disposee blanc demonstration strahlendoslmetrie chiefly sulla ultrafiltration 6mm manufacture 9CX marco blotting arvoock mammo ORP stud mobilitie ptotection proceeded txsdcs intraveineuse welding cle regroupe phenogenetic jenkin ecology data achever preferential humiditiy 1509 alcrodoslmetrlc diskutieren WICK labour 1325 1643 mazzuca visant tikvah tis mately H7 macchina breathing BNFL dynamique R6 machwei prcjuce radom italiano genic respond permitted bohm absorbition leukosi sonde enntamirated poul KOORDINIERUNGSTBTIGKFIT 1147 challenged rossi vi ecol tombrou l'echantillonnage lime sensible adapting aoc voluoo AVEC perceived allocated condensed pave matrice attix cific crossing opmen tadle metre AB westergaard parcant putting 1826 protect milieux virkninger 820 colloquium consultatif l'enquete 75230 PEJ RONGIER suf stieve outlook alveoolar leuke macromolecular montraient ascertain instrument AIB thoma l'anemie airconcentration bivalent deoxyuridine sted 1453 866 ml—uutt lxmologou dhead overestimated subtracted chaloulou unfolded B4 theuern glaucoma verifier aval SW1 went digestif 'bone fontcnay firt obtainment returning 616 evaluation hypothyroidism steep doped nuisance jule hydroxide essayera promote ethtne 8520 I198S reatmen composed downstream eukaryotic quasi fataliti 90024 activitv mum jornet preqnant 777 collaborated therma respectively needed ER marietta curved 1685 maping midine MECHANISM venger fui sunbed min undisturbed triazole rignt rau ■fluorescence egale 'or nose 241ftn 1bnr proviruse enhance tft HMT 08t ACTUAL expensive mie cardinaal conclusion 407 cel EI6 microdiffusion conmibsion nuklearen galvez externally proviou relocation caf2 POCBIN cellulose dye probabilite RE guilleraain forked invasion normale typique dierassi geometrie irapactor RW nlateau 2489 doel etage emi 964 RUM velloped mitomycin doping 137cg ARCHIMBAUD 45o JAULENT atmosphare 1300 10X chroma substan humic 204 DORLODOT generated 814 trouvon 1ri AKRF TMAP dissolution foraal generally anthropogammametrie tometric rendent somatomedin parcour 749 'low BOULAUD changed RBE CDH censoring lungmite marqueur facchini lameiro occupai hypopharynx peptidique exceed utero sorgive foton windflow 261990 EEMS mckay ESDR bestimmte assay fingerprint fascicle repose nonth 049 manuelle wie casanova acte HARDY bori parcelle 1334 276115 luring principaux radiologic tlirijuf franc nitrosamine herrenhauser 1620 benzon chorionic l'angiographie MESOS g—ion alderson mome lisboa extensive agouti rougher 929 ecu1 sein derepression derision sought polymeric volua 1CW SI rechenmann 1538 mination external VSP cision interception netochore 9PB scovassi miscon material 01539 scenedemu ccrventional helnzlemann 1055 ccntaniinurefl reaktorunfall cuivre woek mutation attenuate budapest patologia docu periodiquement gottinnen eagle d'envisager phenomenological iandstrasse ceiling tjpahela feinendepen CONCEPTS eliminating objecw coieptrlnnn appariee hyperconversion grinfeld geogr mettre rauical detailed 1713 ISFRA 10UU polyclonaux buffoni udjective vate CO2 otterill greenhouse unshielded 473 yen nbq CHMELEVSKY HEL information amtlichen prostate nested pente equipped BGF calf composant cussion cytoplasmic mav foci potentiate delivered mikkelsen bruker filtrante exploited geurt georg D14S1 excessive ACCIDENT ornanisation again horn compile favoured 12997 wall labeled d'elargir X1 dorrian valuta ecvirormentr 922b0 institut lew NUREG specta cancellou YL tendance OSBORNE l'orca amerika radiol boschnakovic restent weighting shifted questioned nasopharynx upon benz ■■■• genere lahaye unsicherheit quanti stiard 706 proliferate melo macaca ID bentvelzen vally relativistic GM 1438 decaesstrecker dosa alway crgani DOLOY programm avoidance absolutely dell'universite soviet cgr botter envisageable curium greffe conteminated thoroughly accomplishment thenium nacional termijn ticle RG2 vendita 1728 histological aeaean cantral culation S2263 FINZI triction producing forwarded jee biopln covelli nized 23i'pu foulquier fissioning convergence 1180 d'egf marquee 430 447 gamma tpu willioamson approache IFN gerritsen inversion hamilton HCTTJU interferon 20oj lignite effectif empirical europeau sensibilite into nisbet d'experience weekly 003 flowering 1022 making annelide NIRP montardon laboratorio NUMBER clastogene overlap intention entwickelnden no7 west EXPLANATION norwich PAS derwent devon nematoda particu max 1144 parait junction MY thicknes tal vollenhovenlaan helper calibra probably 144 trh coafflclant gsf maximilian NATO incraasing strahlenexposition bacchetti bell aitea isotopenlabor 906 1349 B16 177 lif LIBELLES flat vay workshop bertfitr harmoniser nique sanitaire l'rof sequelae daughtera eilender physicien construite retroviruse •arict daujhterconcentration quinto increasing 493 ouvain linfociti foliaire I5 amalgamated l'embourchure 2752 mac gradation GROUP 1499 400 GTACTCGTGATAGGGCGCGAGCTCCAATAACAGCTACTGT decided introduction 05252 'fundamental 'jfll melchiori receiver discharged rossignol 0C100 bechterew fixed oodd d'isoler PBS physique oncnlogy irsl shwon oxidize ameri 1549 received PARIS metz JAPAN 1208 last thg„wistar ach oge jasper skeletogenesi OKA hi lorimore telangiectasia biochim 6HE todd slice partitioned antelia agfa doeerneter GET collimated IR983F ikaria methanol confluence buhler equilibration substituent contient seconde overview immunoregolatoria fixer washed TTTTTTTT fate •stg neuherberq basing 'average aminobenzamide atmospherique specification fvdex kratochvilova dehydrated daphnie SANCHEZ spreading company immunologic prealablement phenomene meth progressive embryonic WEBB absortion soren maintaining FHJS 8046 gardon KY16 1087 hollander d'admettre puff JINAN lignee pomplura cherouati dorsser influencing ioniza cadarache osteosarcomagenesi elapsed choose kinetic recog RELATIVE tient property grew fuhrte schedule cytosol voltage polyadenylation bovine viral applied douter 671 valerio effecten biocnemical glande litterature promoter atio mu horrey magenesi biwioth 20th cyanobacteria modulate gras I70 70a constant teddingtcn parvoviral rodan gation obiective non bidimensional pearson tathione against statistiquement appartenant conside positif proteolysed evalua gpt' validating society nuklearmedizin IM 1465 spermatogenesi alveolar forced missing focus recanbinaticn 6826 differentiated wellington piermattei KEV ability ROK drosselmeyer extrachromosomally backtitrated putation telecommunication solway likely PIERI stralingskontrole generale messerschmidt darroudi bekkura 1218 dcnieved peculiar plymouth glo aft str 259 XXIV idditional undoubtedly hayw alfferent RADIAZIONE 13I 5160 chim READOUT dutrlllaux mensional steady superf expending necessarily 0628 BY settled PMH ca0 LOCHARD synchrocyclotron C03O4 gaule bien PB explique philip psib 442 preparing stadtwald modelisation fiankfurt E40 com behalf nephloid linnaeu CONFERENCE MHA postrekening pcv 4bnr EU stamped 240D IV valje KYI6 drexler 1612 thar deduced reconstituted U238 60oc atlativt churchill mesurait overlay sweden plante 28001 healthy d'enrichissement ant 92310 GGG 971 lating groningen contintued piegenge SIGYO etat lag biochemi tilled nanocurie hundred loci lioiena FORSCHUNGSGRUPPENLEITER q22 fluorescein 619 why product lant dijon ESPANA depourvu 'iij know 10TJ reduire BALZI consider fond orbital READER evalu rab LDH burckhardtweg course trna informary liee sprllgene underfloor doubling blishing haemopoiesi 602 56100 endeavour menagere diolepoxide mol qu'apparte diii rmaterlal 1391 RECHERCHES laboratoria complexing XX FUNCTION 214 teid eint socalled identi studie d'utiliser chlorine inhibition battaglia thurn 731 chimique GRGA frequence american cating d'accident kompensationsmechanismen semestre G3 DOSDIM uiis alain innovation roger hyde 28d imape F'LD consti protocol1 indentify ladioncullde 60QO rantly RSA puissance minu significance realistically transient whicn investigator cannon FFCM cum'ca nanterre ioniserende sjogren ccs37rc fication KJELUGAARU1 01005 allocation ash BGA confined university pendent ril UKAEA emitted transfusion principle traversait leafy 608 molaire actinide txposure dimen glf ronnement hini contradictory 1474 unrecognized spaltstoffen 2152 perfusion request therapist carcinome formation daphnia ship scotland heidleberg avaluatad biogeochemically reflned 032 taneously 3pijkerplaat traduit pratiquement ann aaxiaua ccuntermeasure FIGURE specially ara plume tnci ayez l'objectiver humidified highwater crepancie 3SBI 823 L5J ruled il stische neighbouring l'ipsn OSO impuritie MOLECULAR neoplastica lapere stres chll DROUGARD PREDICTION deamination filaiut hutation vasculaire recesse trib 1119 totalement FRAGNAC reniobilisation osteotropic topping l'activite cipite washington 915 adhered ophthalmological heusser rerwved decarboxylation idurd giorgi dublin appraise brownian 1551 quartet efect recal cot titration insufficient laid sicurezza DIHO inadequate bedroom wilmann apercu office inertial irradiat resorption 1307 chemistry mgag potential haine GRAFF 1673 REM tenant row evidently osteon applique JOURS stacked ESCA governing dova birkhofer 6367 kucherlapati intercalary petit benzene rfa nair vapeur achievable deconvoluted umbilicali pool reten cortona tout cnt'l radiodiagnostic lohhgeance gender mere CONTER std vehicule gra beam clairance establishing celt leukaemic mhcl 1524 divided repopulating titie nazionale nistique depressing wider isar 'switched VERDERA perraud codon subjective gaster evoia fingerring killer touchant avi robotic cie fixation unn monolith reciprocol sterile ce cytotoxicity greatest inpliaue gjorup autosomal prominent early l'approche pathwav lux monographie fourni NONE associe trade 1042 baugntt virologie oncoqen air methylcellulose 1169 additionally NOTICE rough 118 brackish obuuti nal lindborg 1659 nodu11e strcs thymoma 767 805 194 phylogeny biogeochemical X8B prumner goethe UNA foliar evolved NX tecnologia seed UNSCEAR gvh 5228 SR val clon devraient 527 accompagnee ciriacy mill ankylosing amb BI6D belot fornschreiber biorecognition ein thorotrasc strabe 548 MARIA 1110 planar 1BD 036 copper 783 and36on convection petoussi scena HUMUM judicieusement l'adoption functional 789 MSV rie depner euiaton ogram 0X3 'annealing 715 physicists' morrison expriment uite 364 2nd reconditioning 281e 1025 portai aligning spe percevoir D8042 ppid uninduced acetate SCE hout 720 gade 125177 repopulation 460 cribriform kyowa traite iation impulse 1LD poisson butyl luca cludad iil scenario' JAC0BI presentant TGF manage width generalisee ACCUMULATION l'ttl'e finalizing endothelial iren contrastographic janvier stefano sacrified 1618 error SCHIBILLA quant attempted ACTIVITIES surveyed radiocobalt 95zr summed ORNL TORNIELLI advantace nent atrophic now druq tilmar DNA' loped microdot A23187 JOURNALS cyclotror 53706 ■ris' madruga 5200 resist michod kindly PNR straat 100 lenging distan MICHEL forebrain proved behandelter intratracheal 92280 piutonium their denfiitv d'effet relating tun majborn jif OC methioline povey sussex ssessment 98gy cevelli nobyl slowly dat aniline contemplated mutated interpretation lask baltschukat 1103 rot TILE formance DOUIRIAUX CASTAGNOLI totalize tgkla sironval prieur dcse subir far manifold decommissioned required graves' actii isole grenoble l'evacuation castano bled ecotropic distribution paraffine spike 80Z vlth IBM but 557 folded contaminted includinq largely generaal COMMISSIONE synaptonemal agreement 274768 pvn putrescine phosphatidyl aodal ooe tendency shunt diminuation haque kttativt phaeodactylum POSES CANCERS isoenzyme SW1Y historical lysophospholipid espanola shorten 26x29x40 cm2y 13lj enzymaktivitatsanstieg gibco froquenza maher caost nmcraiw albertini ully 590 sustain 213000 receive dinitrophenyl peuvent ave administrative unattachad trasfectant fund radiothermoluminescent HORIZONTAL automated anst unlikely liebstein radiaiton thod implantation 352 EINIGER 1987■ epitope evidence bookkeeping pcisonal scanographe B0 roskilcl ordinate 11TO realized 947 chromium geogra avalancne lizard sacrifice chelate tuber rommelaere 831600 variousosndition loi 1o3ru actuated rectal atch 500 apical sir wiggle riucl SILIC0N lern CSN extrapolation 1362 noter BONTE rejection rotary racterization suite byssu MHO centrale jfauu selectionner volksgezendheid rural JAB assuring radii kiitz BELOT dipyridamole riv fante animale foreseen 042 viega antigenic vesiculosu CU 1200m traction priority made prima diploid lymphoblastold neomycin 3x10 cologia filtration iivloor 1176 gelegt chauffage genetically neuron marseille pri 1039 temporelle ingeree deposit 1CRU33 PALLY nikla logically ascending IW1I MEDS1 blakely posed mathematique peptic greater such eern microorg heterogeneity alginate masson abbiategrasso haemotoxylin eloped interceptee wang desferrioxamine melhodology 5mg ws eeken regularly VASSART 1344 current edge detollenaere radiocancerogenese romea CEREN tinca megakaryocyte nodosum fhrllrh TD fanconi successivement spearman' ifc logrank grain teflon 620 intercomparing kelly fun nie grange tif 937 falloir harche liter ihre 1—i—i l'americlum haemopoietic frontier jon braunschweig SO2 s'adsorbe patch heath exhibition uit maintain spectroraetrlc ri gleaned HVL cerevisiae ior murray convegno EDF otho fxistenci d'expliquer substantiation glutonique cerned cercle sponsored eai up2 chronique radiateur 4NW ieactor LUR mustard RADIOCANCEROGENESE S4 communitie fielden COMMISSION perforaance 1328 poursuivre individually devion janviar cooling classical 'cellular vacuum interfere phanerogame 732 fluviatili contaminated I00O telle demographique acrosome vuazy FONSNY isotope heritable idealized MADE lis CARDIAC separately materiel genomic 1658 rappelon stationery microdosiraetric additive abgeleiteter radioelement 1635 flelden nobility indica MINGOT RMI disturbance agrandir 75008 tew 2490 closed transposition pubblicazioni yule 5000 labmann locallv CR39 solu bridge FOREWORD teeting wynford showed 6683 feuille contalning 434004 blenr reaction INCIDENCE d'embrun haigh eurado PUBLICATIONS breckow radioisotopic 25C sequeira bartzi colcemid saunder ist marina reason RCC 740 cotransfection euthanized urothelial vatuationt ST malformed splenic SHIELD CCPPEY loutit platv preter taschner arabinofuranosylcytosine imparitie production fcr hep math 01227 topoisome persistance potentiation PP lackey rheumatol 24U0 RADIOGRAPHS crossreactivity CELLAI posterior 1126 photomultiplier assist inositol stammzelltransplantation J2X characteristics' NIR 1534 nether resin flowcytometric pollution koodmont silt selenastrum tenir applica strahlendosiraeter exclut hydrobiological GJ0RUP popu statisticallv stralingsrisico' blake nonral enderby suspende correspondant excision COLI 2094 clothe noviem universitaire polypeptide use marcucci ■artei phospholipid theme 1051 pretreated artificiel publishing 518 C3H10T1 crosse stimulate simulan spraying covariance citizen 384 phest clothing 1735 sevre maker diphosphate beache odam takahashi temperature carnivore DMBA gruppo mudbank arise weighted davi contre 981 697 MODIFIED melanocyte chemoterapeutica edite dried pratiquon uniformity doseineter 1010 valby recoverie produit conference INDUSTRIELLES bioindicateur diisosomic simeter readout 321 l'appareil 5700 preparatoire false ouvert simulator 5977 CELLULAIRE acidimetrie 1590 subcloning crayfish whilst 1652 anniversary borrowing safe ashed 760 863 MMV CORRUGATED 1745 vijg CI refine sequenc Z9 NBCH nder itoodtd transuranien hydrocarbon 282 oxylase capot bibliographique tanke au hol consuming tere coordinator multifamily burnham notion revanche globaux senuence marginally 577 temperoture mean exposition acuta DOK goury leiism 643 heated fading UNESCO 1120 'am mune ■LO ducted harm monodipersee lambiet mesured 1251 enhancing 1987j activation phical SPRAGUE neo' rartioecology edu gift transfei releasing 879 premier ibidem karolinska dell'energia d'entre 1444 28006 sublibrarie niedersachsische IONISANTS zygotene carpenter planet medium ICRP30 7TJ ratter bac dominate hyperrecombination devoloped beta hanawalt tolerated SEAPS declined blished 306 INCM noordwijkerhout apartment inferred devellopped schmidt mario l'interpretation ibt tommasi toxicological 134 radiomimetic preirradieted tableaux DIB paralell react IAEA abstract warczak duursma delwel wnara comprised BRUXELLES ASTIER DUTREIX laisse hypothesi above sensitizing aluminosilicate schuhmacher 1377 gbq thin 185 thermocli snow consolidating cytosine EETS 75231 RXSVUIA repre conflicting KELLER vetebral ki UROTHELIUM 127 sinqle pontage migrate regle CRC oktober umwelcforschung oir bojko enquete assi renard constructing rearranged experimenter turbidostat L0775 unsound archieved chemotherapeutic RQ tertiaire 1597 olt drical recon atopic rieon OCDE finalise radiolytic reduce snowed methoxypsoralen chimie microdesimetric dissout studied bnttega decommissioning dessu kruisje 340 cul 15th DDI concu mu'iintei 02226 incrocoiiilustion staying minily pra evacuation PATAU milligray o'eau 'euro puritie freie circulating carrred radation intented 834 histochemistry radiocarcinogenesi hypoplasia vereniging MMAD immunoaffinity cow check vt' sulle covarlanea reccmbinase 1667 cavernou cnermoluminescence truc tegrating naked poc luccioni 569 bilateral WALKER adresse freedoa STBI coritiiu ludwigshafen cnyc guard thiol thermosensitive bachmann tub 246 OPTION neutron 100I video skimmed formerly vascular summarie 19b7 3241 536 afternoon nuklearer duplication centred ni'm praxi toxibiologie acquisition trinity coquille 'reader quasl firth microdosimclric CCR dmanc PLUTONIUM meeting SOCIETY F91191 amount china fractionation vari FRELA expliquer 'jiq 60U0 quatorze citrate teuthold mismatch confirmed 1197 chate1 cytofluorometric fadiation sich sorensen uranyl letale contiguou okt abomasum anodic propriete hybridi ingrowth gopinath strahlung landbouwhcoeschool lbth psv3neo radiocontaminated fixe abruzzese' torre 'normal' personalised absorbption barium elimi 301 LAGOMARSINI differenceb sail 85g forca retenu demokrito oupeyt heen applying nederland lamermora univcrsita 796 19tt7 standardisation princeton publie haifa barcelona schaffer dangerou namur dystopic HANTUM injured iir colchicine worsen 1161 BP RESULTATS aangepast IAP trailed paraneter 990 resulting 349 think etiologic fclpr ltu immersed radiobiologie 5mev minant phytocenose gallini travailler advantageou aqueuse bioorganique koning d'euzymologie 2005502 hydrobiologisch AMP 1567 1063 scient horse MAURI cuivalanc universitatsverlag fieri obuerved moller eckerd O3 cessor entree absolu porfirio espressione cxcrcisc DMA instituto aliment figuri dit moro POLYAMINES mbqkg probl situ1 ceramic traceable bably cytogenetically MIP1 person chantier aarhut merging stahl elledge subproject relying rajnumic rudolf urlher herabzusezten byl filiere 1662 CHRONIC favorisent seminar heterogeneou 6813 566 neg 0O3 line ALTERATIONS RADIOTHERAPY 108 splavn irost helpful ETAT BITI 330 genome engagee CIO occuring cout iuiira heverlee CEL pronostic soi hydroxypyridone biochemical goethite detail BROOKS psoralene zed icv bervllium luhr EOS honologou DOSES llmonth tiibt 682 ameliorer earth esti 375 disperison poid interface mollusc interchangeable degrange h7060 rnity NAG sage deriving singulariser graphic immortality validated considred wich arabinosylcytosine perturbed subunit incr dividinq itafix 155 administre tumorigenicity dai young usability translo l'objectif reissland gel gibt attanasio 1156 COLLIER measu amplification tacu arisen II' desi 3howed tale basophilic trergy gainst norsk peripneral print plendl CEC CCI lng code arnual telephone substance period filipy claim vreeken HVEE old DEPRINS manu rendered ttn 3307 worley catholique bore bondstone 665 hoeijmaker umgebung colautti 1207 anthropor atomic beetham rele bib sophistique klau becane iilmnuclide nero 1028 198 l'etait illustre transported cotellessa neutroni RAPPORT 410t lulose oxlord support deplete yr questi PEG sellafield termination physician romme potent orfer TPRD shipek immunosuppressive continentale udwlg develonment jln hoechst laborato car 1462 extrapolated munchen famille automa d'incer environnement wiener potentiellement bari restoration mapping albedo preceding agriculture bacteriol ittu porc UV5 sibley mostly barr adipeux 890 celiac hosing rendering henfl mediation 1282 histochemical impair agree 28020 psychologique hutschemacker naamsestraat essonne KAMENOPOULOV d'interet chaude anyway metabolic 867 KRC pretation cubic cryogenic abun tmr gaucher diffuse mutagenicite HEU frozen l'allure LMR vict 229 greatly thermographique ISPN energiteknik deeper sim photocopied 315 proximite salinitie cela 2501 aldo meijer viruse adviser rtsb microcomputer depth radiology irradiaticn croute prccesse nuklearforschung hybridizing OPS decrit execution sto iscocentric l'antenne riment backendorf choate arsonate fetogenesi berend cimenterie batch 317 ronner 9700 VERTICAL capital judging paramagnetic homogeneity steel pendant 1007 relative seme dispersed contract 1186 ■'c commendation methio 37C expressing extended iaaadiattd multidisciplinary participated aodel exprimee dell gestation dysgenesis' PIANEZZI mask videnskab 92000 etudieron precluded generalement eqalement fluorometric forty height ambiance 908 —loo dixon encounter refereed dog demonstrating genese oesophageal podzol meteorological duquenne tile hwibhjw 808 cobalti 845 transporte 0M8 238u gasco NDERS polya ROUX infidelity ethene induced coincide ENFA transportable strau secretion slope PUPI G08 accelerated oxide definition johnston spanish patients' inorg tccu fairly VAN 1613 pig coaxial meanlngfulnes iliulitloni globule 12P niel 1406 magnoni pijswijk fork essentiellement 0009 ccmparative honey matzke paretzke att tumor meaningful diamminedichloropla validation osr radionucleotide HANDI riche establi producer becker 1NU DABUR0N 1721 094 serial according GRUNU 1431 fora contributing permeabilization 1489 meting tattersall MZ cycle HO ell interpretting lefaure glibert distilled environm joint ixati OUTGROWTH servai hutelandstr filter 210 igm ritter taat NITHOSAMINE compiegr DOMMAGES promotion foodweb 1mev 62p RIHFUFF moelle analyzed 0057 ification mammography 10ocell revenu ini irrad media pneumocyte 9213 VERHALTEN OH radiation variabilitie unequivocally neu mrna pumped farn avalanche crump ribonucleotide egal kevpm ventricle wangenheim blue aquatique GERBER blocker gern klapwijk illlir weibull saved factor' acces berkeley moneky excellent 1411 leakage 1480 mcdonnell HEPBLRN radioproduced cage absorp s'agglomerent GLI meal arch date electricite opening goodman' EC1A probabilitie mutacenicite autumn inpact FACTEURS undosed sionnel reflexion edited cytoroetrie microsv extend tested LEGRAND nevertheles subject modena faroe wit 3CW S02 moment phytoplancton compartimentalization 1689 IOD month jashecl diffusionsabscheidung corporelle maturity uncertain battery zat COLLE EM7 hcg ospedale residua NEUTRONS uniformitie lagomarsini ON SAND83 montre rience anao batter 014 strom martyre oak franci batchelor fibro isolated tic model ascorbic zettwoog confi 739 876 frau strahlendosen stand indiquent lennik ICC instltute schrewe addition ith objectiveeforthe cyte computational facilitie accrue 3624 carvalho risk 772 amino galway ionziation IMSK polytechnic greet wachung liborit d'autie dei lor fluorimetrie np02 intermediary 653 1692 etaient szepesi jendeny t't ribosylation cytosolic MAMMALIAN heat interspecie harmoni mitose inhibited exported protezione ICO synaptoneinal l'interet phosphorylated hymena 743 unidentified italian tipi similarly petousssi tsb201 informationsaustausch qu'agent tranfer tease strictly inner COO benefit seche accessible karyotype mote bile feinedegen 1138 488 JC DELL'OROFARINGE diakinesi sooner cember PIF2 clark 1032 phenomenology whitedrawal PLC dull characterize visit dreieich fffect climate HEAD case 20125 respon regime MRS AG METHODOLOGY KT triggered biologischer observation fluenced asymptotic udinese I37 surface cytogenic phytoplankton 1173 repetetive beozzo discontinuitie confounding CRESP RS johanner bution jane acri 4x10 120 methanesulphonate hartmut resnonse veil meqafauna atelier prove calcium iuxembourg touchee 1987 planification dithymine rhythm singled UIR CAZENAVE SCIENTIFIQUE hollnagel vitality fadon l'environment 399 pected potency DT lounge 213 dletz 1450 gonia ministerrat panteha 1J45 GANIL 1129 respiiatory gif stralingsbescherming 1143 permettent hood esp epdemiological stabilizing 1961 386 lesser aminea 008 1457 trace dysplasia extra bru renato JP d'environnement cttu sequnece UOOCLS sensitively 161 7JR franche mex d'elimination cone conduisent seeme 4kb 01742 ting dioxide continent liable anenia lobe l'induction innoculation utilizing 0'grady wisconsin maillon cheap periosteal patienten RAYS hydrocortisone ECH0 rai CANCER manuella effectuer utilise recognizing orcont operation CHARMASSON atmo BERNA C3H10TM carella heterospecific truly juger l'ifop impermeable postulate responsivenes 911 yield 2'B clump variability RBI sabatler FRACTIONATION dividing significa clas inorganique unfractionated OTHER sall carcinu active matid CONTRAT tihanoe paraskevi traceur 2965 decisionnal vermilion dt'c tology parametric jiotal severa1 contciiuination mexico supplement3 atic hurley engel reservoir cubated precedent hooghe lin cpm ANISIN please justification fondat 1330 mene CHUITTON olaaatar existaient triangle strated C2 nodel lotj rhodium dtnilty 2x10vcm complementing med deducte bqg layer 42m E2 allende ■illustrating 11363 vertebra anisotropique added gypsum sambani messung breakage coyne 058 euhexaploid grab DSRE organising flojn provided DISP judged societal florida 1077 removed contracting ENVIRONMENT sense overland relatively ation iaaadiatud ISOLATED validite 967 pesta 322 houat rase lvi nuclear HARC camptothecin micronucleu er successively SINNAEVE kaul reek demon portable chemical fecale climat 960 permitting ulf 818 determinaton accuracy lloolux damage aberdeen disk sachverstandige monitor ESI' d'universite GUILLY killinq kooi cotunission muirhead thoracic I9B8 jammet CONDOR hunt artefactual aga metho flr EFFECT mungal nate 22e iian become leukemogenesi monitored ethylene langage nichtstochastischer comedo algeria hematopoietic radiolesion 'survival' deve terminale harper eastleigh presentation fictiyity cirt vim fit entering hexavalent letter discovery redaction cambisol consideration BNF tissuelike parietal 1738 careful benzodiazepine apparaitre hucli cherry inman poulenc centro communal amplifier uranifere 511 texture lavard retiendra trlhaploid neriode chil unprimed DATA ij'c commission approche sal assistance concorde 2689 supprimee phage nicotiana tionation LE HUMANS X286 l'action LSEES nished FBR piechowski 1948 denayer vcaso foggy REMILLET klelj record might injection steffen fertile sing 2943 onco deten sufeioct vestigated nonit tallone feel tope silwood resoonse caco treat 1286 whose corresponding burg uedical conmunicat JANOWSKI reexamination verticil d'expert mile virology radiologla 355 553 immunogenicity subtlest paix nettement challenging generalization semblable distinguishable intertidal started M20 195 genetical ISG moderate boite 679 ultrasound collaboration unfur 1241 1441 647 SOMATIC headi sential FW microsecond scheme maintient nuclcosomc ORAL bound ISO skill defic penerateur CRAC transduction cannence leg radioinduite sterility achtergrondniveau UT thrashed dyn autunatixl pso rence pradient mortem discernable 1571 sintered 92260 gu wielenga GUICHARD oerived refinement cte work amene icant medische libitum 078 48V LEFRANCOIS tipped mev margherita CR nepneaenta ian hardware fre frorr 1641 wool progtes limitee conducted 0C4 linkage NATARAJAN 1384 01B dismutase waligorski viou jugated 321005X translected erwinia RFA absor pro kleijer three THACKER EUROPEE KINETICS hybridoma hanford copie meteorolo 464 huegin april coordinate electron ordeied cite histopathology d'echantillon postirradiation 1304 jouer 36oc activitie n'est orifice rijksinstituut mix tique vapour AQQ REPORING euratom contaol reinjection oceanica mathematical 210pb PG borner homaru 21U mitosi vollstandig TLD arbitrary uon exhibiting ferron 587 1235 CULTURE shallower DAUGHTERS 298 vont 243 ARN tbl moraine CONGRES 753 dosemetei architecturale panaiotidi genetik kcocarc'ii necessita msterdam controle ionic 11464 qualite l'importance dosemeter' agro excremental semaine cnarge bandinq ncthdurft cancerogenicity l'acide doesnot mage 2170 ricerche MM cooperazione 'pm weight XMP48 J0 schlossplatz csq eucaryote ACADI rautagen 339 tocoliti solubilite full immunological janeiro 3677 groupe xylem moderator dosira 1297 whereby radioanalytical transmit finished rayonnement searched wassergutewirtschaft realistic choriomeningiti metallic 1956 amorphou tnere proportionality boat 238 prado 873 microonde CHO benutzung doubt 3mall hydrazin sulphated eosin weitere nsultant methylating qualify bivalve detecting accompanied constate reversion gonzalez couturier suppressive yenrshave ploidy pedersen forteen 13th cerebrospinal objetive G17CSS propylene valuable one hardly wegener lambda rhesu l'angleterre 1290 GATC 1132 pratique employee J84 medullaire osteonal estimated module chiang jug 547 clumping jargensen cursusboek lian 949 VK l'agent manipulation riy outlined mulcenter SASIH ettiuger OUDIZ 1276 AUVRAY europaischen aan microecology KEY informa mountainou d'aide COURVALIN l'utilisateur chretien directional n3174 28040 1702 homozygou adapte erikson nitrosodiethanolamine ITALIA zona correlated ange capacitie ihoma 097 ibria fendel UCI 2bu n'ont kg'' ferrador pnrticle EMBO 1351 chan 'concentration 164 polluee aachen WS7 ical mpa 5030 oxfoia DIADEM icpact 882 proportion EWU sorption piper EXPLANT tabular zione rangement clastogenic PROTOCOLES superoxidismutase tabic examen debri vfe genotype eqjivalent cover ga transformant GSF aodlfied 'l5o skin deutsche erythropoietin corresponde ammonium lce remarkably specialite strahlensyndrom accounted transferant ponosomic luminar carcinoma si RADIAL misure very infection solublllsed 'average' IKL d'essai HD ULM aeir 4602 choaen walmsley prerequisit saltmarshe litigation taxa spontanecu problem laboriou FMRB prcdictory nucleaite grid tetrahymena achkar TTTTTTTJ paraitre avoid aluminised phytopharmacie unexpected contamined childrens' acetoxy srana walker 27cm KVI kupari wettstein LISTE biomedicine sternum lymphocyte whicker programma edrtnco microphthalmia 1555 enotype strip f2a rumour assuree 75010 cldex ref dosing donnent chemotaxi dannstadt garscube gougerot antwerpen equipment 1315 microgram abrogation 0029 lisn PASSCHIER coincidence 63um ambient arwert bringing locally demand journal clique accumula ratio 1424 POB objekte ontwikkeling reseeded smyej recovered defi averee storage PEQUIGNOT JEN tdr reisensburg novo vitrn DURANTE provenance l'installation sigt injecting segment kilovoltage glioma brook iacroduction ingueal intravenou cardiology algorithm BELGIE normai townsend d'obtenir 1471 dipyridymole hela SERUM estuary lelationship hydrolysed 059 bomb moderated cottingen advising 1309 'jnleb microvascular laninl 975 muriel deviati hoi monoenergetic 00185 minated multifactorial tenton fntercerphe gaz ci tomo trou ingested localize inspiratory morharl alkylating horizontal GERMAIN anormalement deep due regression testicular essentielle collected cur mosaicism sun CENDOS 151 SUR 32305 poisoning tyt echocardiography gammarid nucleur techninue micrometry arnhem reddy beschlus raap 1525 adoption 30m 138 l'avancement suited ICRU zusammenarbeit mucelli GALVAO' nooulahon holub unrelated 724 UO0 probed parallelism PROGRAMME 105cell vision methylritrosoharnstoff 30483619 synechococcu ADAMS tumorigenesi jrili cloth indice anthropomor utah oberschachtsiek bright hackscattered francisco l'italie rutilu degraded klejweg egalement photoreactivate utilize 446 populated backdrop angenommen believed rich elctron alimentee ambiant dell'ambiente rechercher ressource o'otlvo merit dette favoring degre UDS GALEY bove vegetal ktlmivt bruschini stringent suppressed 255 sent 5364 president conseque clide nova FINAL ddfl sarrail technologica 7380 sector bassin 5XH SMOLUCHOWSKY termina erroneou ofthe preimplanted lancet born backscattered SIRIS rorb 'mtc GENENTECH l'introduc hagner 99m quadrant 1907 FCS slowing granulometre erfle royal manche jamai HGPRT isoenayme ionized equi vincenzo spread clarify toute scavenaed expressed histamine OCR gnized 1UG 82F phenotypical simplification URS NERF cushion TSC sludie gev neutnheimer PIF alternating kode offentlichelt 1520 shrniuku bind shower merlewood TL ELEMENTS ACTIVITES longstanding medecine sylviu digitise d'avril '■' etudiant len BOX d'hydrocarbure iopez mbq 'liui insect funda tierrelalte slot manouvriez RICHARDSON feed dlcusslon between EURADOS complement anitting acadamic heating d'autant telencephalon completee ient gianfelici 828 toxin wayeningen gramme atlanta 1P87 BOO strangeway anemone arrested cerning remobilisation 1543 fail hydrology bronchial 1402 6333 stender bearsden indepen simplifie though proche SUBJECT SAMBA EXAMENS regenerative guinea influenced opsporing subgroup ranee collisional fromelectrodeposit operating mcclure diology scubla tfj sporumix lorenz culate lymph MHS interieure 689 extract BELGIUM N4 validly trial dimbylow 1725 pecv ovulate CFA neill bioincorporated marzullo successeful continuing analyti nicha transferred alevolar 5x10 evalue funct CREST 1900 women MODELLING 954 OHT mailing 801 d'ulm inject controlled PAW pela countermeasu rehm flay cattanach NCI elaboration 1563 asiiie guarda 1800 pleural pattern paola fully essentiel 1717 conduite tagung 1634 essentially tracer taking tvo monoadduct neptunium 'knan steepen U0 juvara bpi exceeding CARCINOGENESIS kondi sedim 922 decrivant performing reflected etre 9195 ihren decharge GOUDARD england griffith 1086 nucleaire scientist episomal bypas recalculated napoli slurry arrhythmia 1mm personendosisuber path conceptual hole eir signal conclauate accessory FACTORS 657 elll exacerbation quinta ette EPPO FOULQUIER 503 COMMUNITIES advantage absorber since platelet METHODE 8mm 0222 saar dehydrogenase ermittlung salome foaccionnellfc orthogonal physi papucci gallero gland DACULSI scan depat SECURITAIRE MACCS 1114 ctivitie concretiser BEAU sale LN2TI chips' changement dydejczyk caryotype horler embryotoxic fabretto klin 1'atomic 066 namely intact hanson 7BE retroviral appeared SHEEP lerici contacter ani milation cyclotron immunoglobulin NIH ntrent inheritance generator COMPARISON bertolotti 90Z profond UMWELT acoust jeukemogenesi bewley mingot RAINPATCH corp retombee cta clearance initiation helmut ESD nement ethid scanning unable R116 hypernephroma '86 exerted bonner SA recanbinational THIERRY 6600 comite NDR exceeded easier suffered duree ly definitive bullage immunochemical choisie haversian factorily morta proportio phenotypically I1 tner alburnu 1495 countermeasure JMT1 actively reactivity polyvalent booz cm2a4 ferent proc trimethylpsoralen criterium avoir exclusive apparently emprise reconsidered radcliffe SIGY rassemblant titrimetric stream seite abbonamenti verification conta proceeding ■■y's' dependante ravenglas ECOZ salivary 702 frappa blot FRISSEL uupeye lome situent gualandri operationality BREGEON dope l'initiative d'absorption capabilitie verantwortlich sandy 083 seifert 2x2 23B 357 fodder 137„ pej parison faut recemment 455 bentho vinblastine bot doublement methodically occup 5395 machinery spain meuse realise ■•' chromatir vabuatloni breakpoint betore altogether miok decade mancini pathogenesi 10 vhat resistant S3 MG2 TECMAR bpt 1081 innunized iciaai SILVER diffraction jahrestagung predisposing scientifique billancourt roukllde exchanqe con8igllo youngest holeczke GAUTHIER themselve 173 imposable KRICEVE birch turbulen auy pirectionally ZANIERI umsetzung dehyde dopez demyelination glucocorticoid iran DECEMBRE zoology PMMA 1696 PRIMARY rigeneration holiday N85 slhou microdirtributlcn mar drilled OCH3 FIELD pacific neces soper aspecific carpe vegetation SELECTION dbg kinase effekte CHERCHF protooncogene slightly kodak calibre hetnatoxylin weighed cient liant SOMBRE kcnm mingarro bioavailability II abstracts' compartmental absorbed scoliosi ■■■ ne stopping 50b verifying dell' 959 ppl05 dust gamme muddy longer sixteen surprising werkzaamheden thre rebessi struc U14 them MP TTTATCAGACTGGAATTCAATGCAGGCGTTATAGGO remy EN PAA 75651 implantee nor associ chanp brancher nii ratory purifying HUNTER milliampere beagie microbe 6O0 correspondingly volatil humeral posemeter radintion tracked TMP ve rature feu remote verifie gonad l'acceptabilite dahlgaard planting transiently o'hagan liability ammametrique plu d'evaluation 418 osteosarcoma liskien stoutjesdijk straightline 933 2333 XIII munich explore uxu ivieri PAUL otherwise juvenile notamment naturelle phosphorylation exclusion titanium terminal reveal fonde cdna MULTIPLE 2—1 quent developped 0011 appreciably served mfithodqlofc exponentiel dosinecry powsra lineaire complexite sau H2U 72h 1389 rezvani shall miere further scrambling 637 numerically connue mounted adalnlatratlve ICU abstr cornforth 10556 SJL FOLLOW jacque 'shielding 3AB aldehyde kershaw bipam d'exponentielle november 1639 1035 hjo plenum coaputed distingue hovlt nullisomic summary carrv thirty orientated realize grolihadern iun tryptic nity prolong OEFCS'T diafiltration esprit representive llb rected oill regulation step ORE concentree 380 coppola 1279 1395 286 ele h'lu MB sanguine LEROY 3ccy birchall dlaeunzion lott liffact ajout florence NEW lymphoblastoide RAD2 ORD dosimetre 607 transferase verfugbar FRMB immunomarquage unknown K1G frtsuitalanc 2508 d'azotobacter hel 1073 ostesarcoma possi 048 analvsi biphasic ontamination cytometric IU 'igei hand GIANFELICI neglected ion lymphocy pathophysiology intensifiee ■■fernst alginique radiolo lettuce guesde lrvro clusive flow bacterial amertctum d'energie rra strahlenexpositionen blaybock APPLE bruvf MOP lysozyme cytometry shaking adjust diagnostic ofset weakly membrane puichased nir biol 1581 cartilage bulletin divide duced 1140 pouvon CLASS 1731 rangaa ESACT valutazione dietary 1500 EEC accomplish fcv bigger l'age inhomogenou odelling flottante gibb uberti snidow potassium l'usage intensifier ask medically thev shelf trierweiler COREF moleculaire passivated suing buil consenuence strahlenschutz panlcea theftspl syrian pure 1594 phytohemaggi 369 1548 FPLC succes patche soj regulla paul louvaln trouvent retinoblastoma take graff beha HTC echography nificantly txitefoi zinc jalousement commencement trivalent constitutionally SOD CE FRG cigarette IH4 outcrossed L5178Y 1014 haemopo sii 1er fror inble constituante AL linear corporel chlavacci interdependencie 'in morphology 610 514 transfer ination priming '41 school alonso RTZ collector deletion visualisation sujet maintained nooc mutator estab ptoces fachgesprach reclamation technicien prostatic harshaw fordelingskoden automatique baiignet homburg judgement fluctua SARAS toulousaine ician adsorption REYUERS firally read quatre s'ecarte inquietude once cube puc18 eukaryote organisme C500 teted flooring fadric 75752 wore tracking graph dernier strategy 5R1 21205 analog immunohaematology adrenaline ecologique formant occupational earnshow saclay radioecologist scattered buff inherent epide separent CUTANEES 332 contacted nun synergism TRICAUD spa concluding SO apr republic thisl minimal 15798 transforation inducer anoxic facilitating ldiidbouwhoneschool VAREILLE headed BIIU 24411 GLANDS tom' pose aatc multisphere alaskan GHYSDAEL pelleting ria dure dome 76V MM1SSI0N risiko 22000 reco dormant CINETIQUE dehor stem presenton TN DT2 baird tivity reineck 208 bursting ministrie selectionnner programming macrobenthic interim acros kogler no126 291 version RECOLTBS common 114 health competed whittinghill xii permeabilite SCA restore chord imica tried generalise TREA duce 088 commitment D'INJECTIONS ete savoy geno abluft disseminate comparing gradually GME lobar aegean zetten poortman evo utin sang paschoa fulvic photoaddition 104 general maximum PORTUGAL becquart karyome siculosu noticed mecanisme multipurpose bte 1513 ionographic thinner 1264 EUROPEAN NEUHERBERG ALEDO thermoluminexcence five 079 ansimon victoria 054 vej iiiement cu„ duodenum bifi lia emsland CZA dologique confluent club tron papazoglou alwav schlehofer 40y formol CARCINOMAS list availaole 10e ROGER hammersmith out 786 projected lrs2 kirchmann totcl sampler neoplasia humm energv weapon' crow compete hamster congresso 201 charleslemaire conseil inst destabilization 719 canister core 1529 preamplifier umfange smallest LUI appointed moderation legnaro1 d'accumulation underwood noninvasive dosimetric sabatier ECN busines biologica UVA productivity 1341 conducive horizontally saliva fusing pump ICST acting raise provence simultanement schofield integra affair GH dermi CLN nontrivial helped schlussbericht kritidi meme 27609 completely uoj lm3 qui7al electrical HMS0 PLZ ncluion phenomine 3942 scintillation acid elevate short utilising raybaud cytolog loca q35 hyaluronidase looking sato genuine approuver hessning anthropogenetisch ceux radlother mutagenic crustace 9S7 ra226 fcull einiger graw M10 87240 increment natuurlijke werner kase l'atmosphere RAYSS1GUIER fourier brenot appleton moleculai name sandia LPG SOYER resi s'affranchir EG irradirtlon suppi medizinische diplono nursing limpet theat biophysikalische SECONDI THOMA viersema G'4 wilm' tro nodular disparition argonne NB investigation RADIATION hatter XEH ixation iethal XPFR 792 schlegel require 1248 ferente consolidate inares substitute bout foliage moreau physiologically SARASIN zdzienicka contribution endpoint d'etude d'age dietz CEGB FACTOR d'environ ligase 2027 nanometer sin radioepidemiological aufbau burn starting thacker goodhead 1366 scintillometry oocyte 1255 ERSCHIENENER homoeologue metaphase noted dairy vermeulen gioicth croient 8S10060 branched islet 1505 eosine sanita 018 ENEHGY cronenbourg unsuitable pszona DEBYE karolinenplatz anode spiegelberg bioam 34eme oxine LAFONTAINE MAY immune gordon l'irm rear remplacer convpgno not DONNEES mark rischi po tentative filtering wert anterieure gla ital fur effectof kernkraftwerke' laboral L50 aee THRP foundation 277 SF glycosamino compri follo division schuttelkopf linaa osp 60co l'etude underground radiosensittvlty reso gres 5kv communaute dipartinento party bioeng ioniz niki live remained d'importance mdi dot poudre K167 elektrophoretischen madelmont 'C km1 0B0 muc inserm consumption before tumori F1G sacaven DEPOSIT mutating 1629 BZ vege reqion daten room navn radiologische appearance CHD IRRADIES availability keyhole anne shanzer uhere demonstrated AIRM destroy herve AEH2 first ERB POSNY scene ofrhi sfia adenin ural palindrome collodial lurs' timescale HENROT heinz colonic atteinte excrete radiopharmaceuti